EMAIL THIS PAGE TO A FRIEND

CD160

CD160 molecule

138 Gene Product Result for
Synonyms: BY55 NK1 NK28
UniProtKB ID: O95971
Gene ID:
Human(11126) Summary: CD160 is an 27 kDa glycoprotein which was initially identified with the monoclonal antibody BY55. Its expression is tightly associated with peripheral blood NK cells and CD8 T lymphocytes with cytolytic effector activity. The cDNA sequence of CD160 predicts a cysteine-rich, glycosylphosphatidylinositol-anchored protein of 181 amino acids with a single Ig-like domain weakly homologous to KIR2DL4 molecule. CD160 is expressed at the cell surface as a tightly disulfide-linked multimer. RNA blot analysis revealed CD160 mRNAs of 1.5 and 1.6 kb whose expression was highly restricted to circulating NK and T cells, spleen and small intestine. Within NK cells CD160 is expressed by CD56dimCD16+ cells whereas among circulating T cells its expression is mainly restricted to TCRgd bearing cells and to TCRab+CD8brightCD95+CD56+CD28-CD27-cells. In tissues, CD160 is expressed on all intestinal intraepithelial lymphocytes. CD160 shows a broad specificity for binding to both classical and nonclassical MHC class I molecules. [provided by RefSeq, Jul 2008]
Mouse(54215) CD160 antigen
Rat(502585) CD160 molecule
dog(483158) CD160 molecule
domestic cat(100125861) CD160 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007053 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007053 Rosetta Predictions human pricing
XM_001063397 Rosetta Predictions rat pricing
XM_578071 Rosetta Predictions rat pricing
NM_018767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151889 predicted 465
2 SASI_Hs01_00151890 predicted 997
3 SASI_Hs01_00151891 predicted 919
4 SASI_Hs01_00151892 predicted 983
5 SASI_Hs01_00151894 predicted 644
6 SASI_Hs02_00342855 predicted 1029
7 SASI_Hs01_00151895 predicted 1016
8 SASI_Hs02_00342856 predicted 1035
9 SASI_Hs01_00151898 predicted 673
10 SASI_Hs02_00342857 predicted 810
11 SASI_Hs01_00151893 predicted 881
12 SASI_Hs01_00151896 predicted 478
13 SASI_Hs01_00151897 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306951 predicted 630
2 SASI_Rn02_00306952 predicted 564
3 SASI_Rn02_00306953 predicted 503
4 SASI_Rn02_00306954 predicted 752
5 SASI_Rn02_00306955 predicted 232
6 SASI_Rn02_00306956 predicted 940
7 SASI_Rn02_00306957 predicted 630
8 SASI_Rn02_00306958 predicted 647
9 SASI_Rn02_00306959 predicted 908
10 SASI_Rn02_00306960 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407511 predicted 626
2 SASI_Rn02_00407512 predicted 566
3 SASI_Rn02_00407513 predicted 506
4 SASI_Rn02_00407514 predicted 754
5 SASI_Rn02_00407515 predicted 238
6 SASI_Rn02_00407516 predicted 937
7 SASI_Rn02_00407517 predicted 625
8 SASI_Rn02_00407518 predicted 649
9 SASI_Rn02_00407519 predicted 905
10 SASI_Rn02_00407520 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125995 predicted 513
2 SASI_Mm01_00125996 predicted 751
3 SASI_Mm01_00125997 predicted 665
4 SASI_Mm01_00125998 predicted 717
5 SASI_Mm01_00126000 predicted 479
6 SASI_Mm02_00324078 predicted 784
7 SASI_Mm01_00126001 predicted 299
8 SASI_Mm01_00126002 predicted 623
9 SASI_Mm01_00126003 predicted 696
10 SASI_Mm01_00126004 predicted 218
11 SASI_Mm01_00125999 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018767
CD160 MISSION shRNA Bacterial Glycerol Stock
CD160 molecule
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018767.2-677s1c1
Sequence:CCGGCAGCGAGGTAAATCTGACAATCTCGAGATTGTCAGATTTACCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-389s1c1
Sequence:CCGGCCATAGAACAAGCTACACCATCTCGAGATGGTGTAGCTTGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-261s1c1
Sequence:CCGGGCTAATACTCTTCTGGTGCAACTCGAGTTGCACCAGAAGAGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-314s1c1
Sequence:CCGGGCTTAGAACAGCTTAGGGTTACTCGAGTAACCCTAAGCTGTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-534s1c1
Sequence:CCGGCCCTGACTTCAGCCATATCAACTCGAGTTGATATGGCTGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.3-697s21c1
Sequence:CCGGGGAAGGTACAGCGAGGTAAATCTCGAGATTTACCTCGCTGTACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-615s21c1
Sequence:CCGGGGTGGCCCTTCAAGCTCTATACTCGAGTATAGAGCTTGAAGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.2-905s21c1
Sequence:CCGGCTAGCAGAACAGTTGGTATACCTCGAGGTATACCAACTGTTCTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-316s21c1
Sequence:CCGGTTAGAACAGCTTAGGGTTAAACTCGAGTTTAACCCTAAGCTGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-214s21c1
Sequence:CCGGCTGGACCTCACCTGTACTTTGCTCGAGCAAAGTACAGGTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-567s21c1
Sequence:CCGGTTCAGGCTTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-646s21c1
Sequence:CCGGGGCCCTTCAAGCTCTATATACCTCGAGGTATATAGAGCTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-343s21c1
Sequence:CCGGCTTAGAACAGCTTAGGGTTAACTCGAGTTAACCCTAAGCTGTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-486s21c1
Sequence:CCGGTCTACATTCATGGCCACTTTCCTCGAGGAAAGTGGCCATGAATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018767
CD160 MISSION shRNA shRNA Plasmid DNA
CD160 molecule
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018767.2-677s1c1
Sequence:CCGGCAGCGAGGTAAATCTGACAATCTCGAGATTGTCAGATTTACCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-389s1c1
Sequence:CCGGCCATAGAACAAGCTACACCATCTCGAGATGGTGTAGCTTGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-261s1c1
Sequence:CCGGGCTAATACTCTTCTGGTGCAACTCGAGTTGCACCAGAAGAGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-314s1c1
Sequence:CCGGGCTTAGAACAGCTTAGGGTTACTCGAGTAACCCTAAGCTGTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-534s1c1
Sequence:CCGGCCCTGACTTCAGCCATATCAACTCGAGTTGATATGGCTGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.3-697s21c1
Sequence:CCGGGGAAGGTACAGCGAGGTAAATCTCGAGATTTACCTCGCTGTACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-615s21c1
Sequence:CCGGGGTGGCCCTTCAAGCTCTATACTCGAGTATAGAGCTTGAAGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.2-905s21c1
Sequence:CCGGCTAGCAGAACAGTTGGTATACCTCGAGGTATACCAACTGTTCTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-316s21c1
Sequence:CCGGTTAGAACAGCTTAGGGTTAAACTCGAGTTTAACCCTAAGCTGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-214s21c1
Sequence:CCGGCTGGACCTCACCTGTACTTTGCTCGAGCAAAGTACAGGTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-567s21c1
Sequence:CCGGTTCAGGCTTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-646s21c1
Sequence:CCGGGGCCCTTCAAGCTCTATATACCTCGAGGTATATAGAGCTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-343s21c1
Sequence:CCGGCTTAGAACAGCTTAGGGTTAACTCGAGTTAACCCTAAGCTGTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-486s21c1
Sequence:CCGGTCTACATTCATGGCCACTTTCCTCGAGGAAAGTGGCCATGAATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018767
CD160 MISSION shRNA Lentiviral Transduction Particles
CD160 molecule
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018767.2-677s1c1
Sequence:CCGGCAGCGAGGTAAATCTGACAATCTCGAGATTGTCAGATTTACCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-389s1c1
Sequence:CCGGCCATAGAACAAGCTACACCATCTCGAGATGGTGTAGCTTGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-261s1c1
Sequence:CCGGGCTAATACTCTTCTGGTGCAACTCGAGTTGCACCAGAAGAGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-314s1c1
Sequence:CCGGGCTTAGAACAGCTTAGGGTTACTCGAGTAACCCTAAGCTGTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018767.2-534s1c1
Sequence:CCGGCCCTGACTTCAGCCATATCAACTCGAGTTGATATGGCTGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.3-697s21c1
Sequence:CCGGGGAAGGTACAGCGAGGTAAATCTCGAGATTTACCTCGCTGTACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-615s21c1
Sequence:CCGGGGTGGCCCTTCAAGCTCTATACTCGAGTATAGAGCTTGAAGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018767.2-905s21c1
Sequence:CCGGCTAGCAGAACAGTTGGTATACCTCGAGGTATACCAACTGTTCTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-316s21c1
Sequence:CCGGTTAGAACAGCTTAGGGTTAAACTCGAGTTTAACCCTAAGCTGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-214s21c1
Sequence:CCGGCTGGACCTCACCTGTACTTTGCTCGAGCAAAGTACAGGTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.2-567s21c1
Sequence:CCGGTTCAGGCTTCCTGCAAGTAAACTCGAGTTTACTTGCAGGAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-646s21c1
Sequence:CCGGGGCCCTTCAAGCTCTATATACCTCGAGGTATATAGAGCTTGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-343s21c1
Sequence:CCGGCTTAGAACAGCTTAGGGTTAACTCGAGTTAACCCTAAGCTGTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018767.3-486s21c1
Sequence:CCGGTCTACATTCATGGCCACTTTCCTCGAGGAAAGTGGCCATGAATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007053
CD160 MISSION shRNA Bacterial Glycerol Stock
CD160 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007053.2-1356s1c1
Sequence:CCGGCCCAGCTTCATCTAAATACTTCTCGAGAAGTATTTAGATGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-347s1c1
Sequence:CCGGCTGTACTGTATGGCATAAGAACTCGAGTTCTTATGCCATACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-495s1c1
Sequence:CCGGTCTCAGTTGATGTTCACCATACTCGAGTATGGTGAACATCAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-331s1c1
Sequence:CCGGCGCGACTAAACTTAATCTGTACTCGAGTACAGATTAAGTTTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-629s1c1
Sequence:CCGGCTACACAGTGACGGGATTGAACTCGAGTTCAATCCCGTCACTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-470s21c1
Sequence:CCGGGATAGATGGTGTTGGTGAAATCTCGAGATTTCACCAACACCATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-661s21c1
Sequence:CCGCACCTTGAGTTCAGCCATAATGCTCGAGCATTATGGCTGAACTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007053.2-813s21c1
Sequence:CCGGGACTATGGCTTAGTATCTTTCCTCGAGGAAAGATACTAAGCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007053
CD160 MISSION shRNA shRNA Plasmid DNA
CD160 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007053.2-1356s1c1
Sequence:CCGGCCCAGCTTCATCTAAATACTTCTCGAGAAGTATTTAGATGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-347s1c1
Sequence:CCGGCTGTACTGTATGGCATAAGAACTCGAGTTCTTATGCCATACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-495s1c1
Sequence:CCGGTCTCAGTTGATGTTCACCATACTCGAGTATGGTGAACATCAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-331s1c1
Sequence:CCGGCGCGACTAAACTTAATCTGTACTCGAGTACAGATTAAGTTTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-629s1c1
Sequence:CCGGCTACACAGTGACGGGATTGAACTCGAGTTCAATCCCGTCACTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-470s21c1
Sequence:CCGGGATAGATGGTGTTGGTGAAATCTCGAGATTTCACCAACACCATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-661s21c1
Sequence:CCGCACCTTGAGTTCAGCCATAATGCTCGAGCATTATGGCTGAACTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007053.2-813s21c1
Sequence:CCGGGACTATGGCTTAGTATCTTTCCTCGAGGAAAGATACTAAGCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007053
CD160 MISSION shRNA Lentiviral Transduction Particles
CD160 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007053.2-1356s1c1
Sequence:CCGGCCCAGCTTCATCTAAATACTTCTCGAGAAGTATTTAGATGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-347s1c1
Sequence:CCGGCTGTACTGTATGGCATAAGAACTCGAGTTCTTATGCCATACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-495s1c1
Sequence:CCGGTCTCAGTTGATGTTCACCATACTCGAGTATGGTGAACATCAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-331s1c1
Sequence:CCGGCGCGACTAAACTTAATCTGTACTCGAGTACAGATTAAGTTTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007053.2-629s1c1
Sequence:CCGGCTACACAGTGACGGGATTGAACTCGAGTTCAATCCCGTCACTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-470s21c1
Sequence:CCGGGATAGATGGTGTTGGTGAAATCTCGAGATTTCACCAACACCATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007053.2-661s21c1
Sequence:CCGCACCTTGAGTTCAGCCATAATGCTCGAGCATTATGGCTGAACTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007053.2-813s21c1
Sequence:CCGGGACTATGGCTTAGTATCTTTCCTCGAGGAAAGATACTAAGCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks