EMAIL THIS PAGE TO A FRIEND

CD163

CD163 molecule

64 Gene Product Result for
Synonyms: M130 MM130
Gene ID:
Human(9332) Summary: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(93671) CD163 antigen
Rat(312701) CD163 molecule
chicken(418303) CD163 molecule
dog(477704) CD163 molecule
domestic cat(101094606) CD163 molecule
cow(533844) CD163 molecule
naked mole-rat(101719242) CD163 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155801 MISSION® esiRNA esiRNA human CD163 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004244 Rosetta Predictions human pricing
NM_203416 Rosetta Predictions human pricing
NM_001107887 Rosetta Predictions rat pricing
NM_053094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161156 predicted 1497
2 SASI_Hs01_00161157 predicted 2498
3 SASI_Hs01_00161158 predicted 2412
4 SASI_Hs01_00161159 predicted 790
5 SASI_Hs01_00161160 predicted 1416
6 SASI_Hs01_00161161 predicted 1210
7 SASI_Hs01_00161162 predicted 2052
8 SASI_Hs01_00161163 predicted 1441
9 SASI_Hs01_00161164 predicted 1658
10 SASI_Hs02_00337179 predicted 1331
11 SASI_Hs01_00161155 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148536 predicted 1494
2 SASI_Hs01_00148537 predicted 2503
3 SASI_Hs01_00148538 predicted 2414
4 SASI_Hs01_00148539 predicted 781
5 SASI_Hs01_00148540 predicted 1421
6 SASI_Hs01_00148541 predicted 1207
7 SASI_Hs01_00148542 predicted 2050
8 SASI_Hs01_00148543 predicted 1438
9 SASI_Hs01_00148544 predicted 1658
10 SASI_Hs02_00373349 predicted 1333
11 SASI_Hs01_00148535 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233255 predicted 1946
2 SASI_Rn02_00233256 predicted 2646
3 SASI_Rn02_00233257 predicted 2454
4 SASI_Rn02_00233258 predicted 2659
5 SASI_Rn02_00233259 predicted 2392
6 SASI_Rn02_00233260 predicted 2084
7 SASI_Rn02_00233261 predicted 1342
8 SASI_Rn02_00233262 predicted 2437
9 SASI_Rn02_00233263 predicted 3076
10 SASI_Rn02_00233264 predicted 3245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040340 predicted 2414
2 SASI_Mm01_00040341 predicted 2527
3 SASI_Mm01_00040342 predicted 2620
4 SASI_Mm01_00040343 predicted 2139
5 SASI_Mm01_00040345 predicted 488
6 SASI_Mm01_00040346 predicted 3376
7 SASI_Mm01_00040347 predicted 2320
8 SASI_Mm01_00040348 predicted 3062
9 SASI_Mm02_00337589 predicted 2963
10 SASI_Mm01_00040349 predicted 2638
11 SASI_Mm01_00040344 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004244
CD163 MISSION shRNA Bacterial Glycerol Stock
CD163 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-2409s21c1
Sequence:CCGGGGCTGTGGAGAGGCCATTAATCTCGAGATTAATGGCCTCTCCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-801s21c1
Sequence:CCGGGATCTTATATGCAACGGAAATCTCGAGATTTCCGTTGCATATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004244.4-3766s21c1
Sequence:CCGGTGACTACTTAGTGGTGTATATCTCGAGATATACACCACTAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-1504s21c1
Sequence:CCGGGACTTACCTGTGATCACTATGCTCGAGCATAGTGATCACAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3006s1c1
Sequence:CCGGCCAGCTTTGAAAGCATTCAAACTCGAGTTTGAATGCTTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-1394s1c1
Sequence:CCGGGCTGTTTCTAAGTAGCTGTAACTCGAGTTACAGCTACTTAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-663s1c1
Sequence:CCGGGCATCTGTCATTTGTAGACAACTCGAGTTGTCTACAAATGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3362s1c1
Sequence:CCGGCCAAATTCAATACCGGGAGATCTCGAGATCTCCCGGTATTGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-2158s1c1
Sequence:CCGGCCTCGTGCAATTCATCGTCTTCTCGAGAAGACGATGAATTGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004244
CD163 MISSION shRNA shRNA Plasmid DNA
CD163 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-2409s21c1
Sequence:CCGGGGCTGTGGAGAGGCCATTAATCTCGAGATTAATGGCCTCTCCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-801s21c1
Sequence:CCGGGATCTTATATGCAACGGAAATCTCGAGATTTCCGTTGCATATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004244.4-3766s21c1
Sequence:CCGGTGACTACTTAGTGGTGTATATCTCGAGATATACACCACTAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-1504s21c1
Sequence:CCGGGACTTACCTGTGATCACTATGCTCGAGCATAGTGATCACAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3006s1c1
Sequence:CCGGCCAGCTTTGAAAGCATTCAAACTCGAGTTTGAATGCTTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-1394s1c1
Sequence:CCGGGCTGTTTCTAAGTAGCTGTAACTCGAGTTACAGCTACTTAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-663s1c1
Sequence:CCGGGCATCTGTCATTTGTAGACAACTCGAGTTGTCTACAAATGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3362s1c1
Sequence:CCGGCCAAATTCAATACCGGGAGATCTCGAGATCTCCCGGTATTGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-2158s1c1
Sequence:CCGGCCTCGTGCAATTCATCGTCTTCTCGAGAAGACGATGAATTGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004244
CD163 MISSION shRNA Lentiviral Transduction Particles
CD163 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-2409s21c1
Sequence:CCGGGGCTGTGGAGAGGCCATTAATCTCGAGATTAATGGCCTCTCCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-801s21c1
Sequence:CCGGGATCTTATATGCAACGGAAATCTCGAGATTTCCGTTGCATATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004244.4-3766s21c1
Sequence:CCGGTGACTACTTAGTGGTGTATATCTCGAGATATACACCACTAAGTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004244.4-1504s21c1
Sequence:CCGGGACTTACCTGTGATCACTATGCTCGAGCATAGTGATCACAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3006s1c1
Sequence:CCGGCCAGCTTTGAAAGCATTCAAACTCGAGTTTGAATGCTTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-1394s1c1
Sequence:CCGGGCTGTTTCTAAGTAGCTGTAACTCGAGTTACAGCTACTTAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-663s1c1
Sequence:CCGGGCATCTGTCATTTGTAGACAACTCGAGTTGTCTACAAATGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-3362s1c1
Sequence:CCGGCCAAATTCAATACCGGGAGATCTCGAGATCTCCCGGTATTGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004244.3-2158s1c1
Sequence:CCGGCCTCGTGCAATTCATCGTCTTCTCGAGAAGACGATGAATTGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053094
CD163 MISSION shRNA Bacterial Glycerol Stock
CD163 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053094.1-4094s1c1
Sequence:CCGGCCTGAGTTCAATTCCTAGCAACTCGAGTTGCTAGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2957s1c1
Sequence:CCGGCCTGGGATCTTAATGATGCTACTCGAGTAGCATCATTAAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-1375s1c1
Sequence:CCGGGCAACAAATACGTGGCTCTTTCTCGAGAAAGAGCCACGTATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2447s1c1
Sequence:CCGGGCACTGGGAAAGAGTCTCATACTCGAGTATGAGACTCTTTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-527s1c1
Sequence:CCGGCCTGCTCAGATGGATCTAATTCTCGAGAATTAGATCCATCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053094
CD163 MISSION shRNA shRNA Plasmid DNA
CD163 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053094.1-4094s1c1
Sequence:CCGGCCTGAGTTCAATTCCTAGCAACTCGAGTTGCTAGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2957s1c1
Sequence:CCGGCCTGGGATCTTAATGATGCTACTCGAGTAGCATCATTAAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-1375s1c1
Sequence:CCGGGCAACAAATACGTGGCTCTTTCTCGAGAAAGAGCCACGTATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2447s1c1
Sequence:CCGGGCACTGGGAAAGAGTCTCATACTCGAGTATGAGACTCTTTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-527s1c1
Sequence:CCGGCCTGCTCAGATGGATCTAATTCTCGAGAATTAGATCCATCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053094
CD163 MISSION shRNA Lentiviral Transduction Particles
CD163 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053094.1-4094s1c1
Sequence:CCGGCCTGAGTTCAATTCCTAGCAACTCGAGTTGCTAGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2957s1c1
Sequence:CCGGCCTGGGATCTTAATGATGCTACTCGAGTAGCATCATTAAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-1375s1c1
Sequence:CCGGGCAACAAATACGTGGCTCTTTCTCGAGAAAGAGCCACGTATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-2447s1c1
Sequence:CCGGGCACTGGGAAAGAGTCTCATACTCGAGTATGAGACTCTTTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053094.1-527s1c1
Sequence:CCGGCCTGCTCAGATGGATCTAATTCTCGAGAATTAGATCCATCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks