EMAIL THIS PAGE TO A FRIEND

CD163L1

CD163 molecule-like 1

46 Gene Product Result for
Synonyms: CD163B M160
UniProtKB ID: Q9NR16, B4E0G7, C9JHR7, E7EVK4, Q2M3B7, Q6UWC2
Gene ID:
Human(283316) Summary: This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. The SRCR family is defined by a 100-110 amino acid SRCR domain, which may mediate protein-protein interaction and ligand binding. The encoded protein contains twelve SRCR domains, a transmembrane region and a cytoplasmic domain. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(244233) CD163 molecule-like 1
Rat(293591) CD163 molecule-like 1
chicken(429000) CD163 molecule-like 1
cow(338056) CD163 molecule-like 1
Horse(100060399) CD163 molecule-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053071 MISSION® esiRNA esiRNA human CD163L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174941 Rosetta Predictions human pricing
NM_001106312 Rosetta Predictions rat pricing
NM_172909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102185 predicted 2940
2 SASI_Hs02_00368883 predicted 2508
3 SASI_Hs01_00102187 predicted 1649
4 SASI_Hs01_00102188 predicted 422
5 SASI_Hs01_00102190 predicted 2709
6 SASI_Hs01_00102191 predicted 1389
7 SASI_Hs02_00368884 predicted 2064
8 SASI_Hs01_00102192 predicted 2346
9 SASI_Hs01_00102193 predicted 2693
10 SASI_Hs01_00102194 predicted 1283
11 SASI_Hs01_00102186 predicted 759
12 SASI_Hs01_00102189 predicted 3494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217738 predicted 2420
2 SASI_Rn02_00217739 predicted 1290
3 SASI_Rn02_00217740 predicted 910
4 SASI_Rn02_00217741 predicted 2613
5 SASI_Rn02_00217742 predicted 383
6 SASI_Rn02_00217743 predicted 1101
7 SASI_Rn02_00217744 predicted 1701
8 SASI_Rn02_00217745 predicted 1639
9 SASI_Rn02_00217746 predicted 2028
10 SASI_Rn02_00217747 predicted 2138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099078 predicted 3038
2 SASI_Mm01_00099079 predicted 2601
3 SASI_Mm01_00099080 predicted 1474
4 SASI_Mm01_00099081 predicted 2429
5 SASI_Mm01_00099082 predicted 3128
6 SASI_Mm02_00344896 predicted 3111
7 SASI_Mm01_00099083 predicted 1113
8 SASI_Mm01_00099084 predicted 377
9 SASI_Mm01_00099085 predicted 1636
10 SASI_Mm01_00099087 predicted 2154
11 SASI_Mm01_00099086 predicted 1138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174941
CD163L1 MISSION shRNA Bacterial Glycerol Stock
CD163 molecule-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4142s1c1
Sequence:CCGGCCGGTTCTGTTTATTCTATTTCTCGAGAAATAGAATAAACAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c1
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4200s1c1
Sequence:CCGGCCCTCAGAGTTTCAACCAGAACTCGAGTTCTGGTTGAAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1283s1c1
Sequence:CCGGCGTCGTGCTAAACCTAGTAATCTCGAGATTACTAGGTTTAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-69s1c1
Sequence:CCGGGCTGCTGTCATCAGAACCTTTCTCGAGAAAGGTTCTGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c2
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-2698s21c1
Sequence:CCGGGAGTTGTCTGTTCCCGATATACTCGAGTATATCGGGAACAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1051s21c1
Sequence:CCGGGACATTCCGGAACCGTCAATTCTCGAGAATTGACGGTTCCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1258s21c1
Sequence:CCGGGATGTCCGTTCAGCGTCTTTGCTCGAGCAAAGACGCTGAACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174941
CD163L1 MISSION shRNA shRNA Plasmid DNA
CD163 molecule-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4142s1c1
Sequence:CCGGCCGGTTCTGTTTATTCTATTTCTCGAGAAATAGAATAAACAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c1
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4200s1c1
Sequence:CCGGCCCTCAGAGTTTCAACCAGAACTCGAGTTCTGGTTGAAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1283s1c1
Sequence:CCGGCGTCGTGCTAAACCTAGTAATCTCGAGATTACTAGGTTTAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-69s1c1
Sequence:CCGGGCTGCTGTCATCAGAACCTTTCTCGAGAAAGGTTCTGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c2
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-2698s21c1
Sequence:CCGGGAGTTGTCTGTTCCCGATATACTCGAGTATATCGGGAACAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1051s21c1
Sequence:CCGGGACATTCCGGAACCGTCAATTCTCGAGAATTGACGGTTCCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1258s21c1
Sequence:CCGGGATGTCCGTTCAGCGTCTTTGCTCGAGCAAAGACGCTGAACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174941
CD163L1 MISSION shRNA Lentiviral Transduction Particles
CD163 molecule-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4142s1c1
Sequence:CCGGCCGGTTCTGTTTATTCTATTTCTCGAGAAATAGAATAAACAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c1
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-4200s1c1
Sequence:CCGGCCCTCAGAGTTTCAACCAGAACTCGAGTTCTGGTTGAAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1283s1c1
Sequence:CCGGCGTCGTGCTAAACCTAGTAATCTCGAGATTACTAGGTTTAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-69s1c1
Sequence:CCGGGCTGCTGTCATCAGAACCTTTCTCGAGAAAGGTTCTGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174941.2-1903s1c2
Sequence:CCGGCCCATCTTCTATCATTGGCATCTCGAGATGCCAATGATAGAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-2698s21c1
Sequence:CCGGGAGTTGTCTGTTCCCGATATACTCGAGTATATCGGGAACAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1051s21c1
Sequence:CCGGGACATTCCGGAACCGTCAATTCTCGAGAATTGACGGTTCCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174941.4-1258s21c1
Sequence:CCGGGATGTCCGTTCAGCGTCTTTGCTCGAGCAAAGACGCTGAACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172909
CD163L1 MISSION shRNA Bacterial Glycerol Stock
CD163 molecule-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000124429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172909.2-3171s1c1
Sequence:CCGGGCATCTACAGTCAGAAGGTATCTCGAGATACCTTCTGACTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2783s1c1
Sequence:CCGGGCTTTAGGAGAGGCTTCCTTTCTCGAGAAAGGAAGCCTCTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2965s1c1
Sequence:CCGGGCCTTCCCGTTTCATATTTCTCTCGAGAGAAATATGAAACGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-1492s1c1
Sequence:CCGGGCCAGACATATTTCATTGTGTCTCGAGACACAATGAAATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172909
CD163L1 MISSION shRNA shRNA Plasmid DNA
CD163 molecule-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000124429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172909.2-3171s1c1
Sequence:CCGGGCATCTACAGTCAGAAGGTATCTCGAGATACCTTCTGACTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2783s1c1
Sequence:CCGGGCTTTAGGAGAGGCTTCCTTTCTCGAGAAAGGAAGCCTCTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2965s1c1
Sequence:CCGGGCCTTCCCGTTTCATATTTCTCTCGAGAGAAATATGAAACGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-1492s1c1
Sequence:CCGGGCCAGACATATTTCATTGTGTCTCGAGACACAATGAAATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172909
CD163L1 MISSION shRNA Lentiviral Transduction Particles
CD163 molecule-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000124429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172909.2-3171s1c1
Sequence:CCGGGCATCTACAGTCAGAAGGTATCTCGAGATACCTTCTGACTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2783s1c1
Sequence:CCGGGCTTTAGGAGAGGCTTCCTTTCTCGAGAAAGGAAGCCTCTCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-2965s1c1
Sequence:CCGGGCCTTCCCGTTTCATATTTCTCTCGAGAGAAATATGAAACGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172909.2-1492s1c1
Sequence:CCGGGCCAGACATATTTCATTGTGTCTCGAGACACAATGAAATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks