EMAIL THIS PAGE TO A FRIEND

CD164

CD164 molecule, sialomucin

186 Gene Product Result for
Synonyms: MGC-24 MUC-24 endolyn
Gene ID:
Human(8763) Summary: Sialomucins are a heterogeneous group of secreted or membrane-associated mucins that appear to play 2 key but opposing roles in vivo: first as cytoprotective or antiadhesive agents, and second as adhesion receptors. CD164 is a type I integral transmembrane sialomucin that functions as an adhesion receptor (Watt et al., 1998 [PubMed 9680353]
Mouse(53599) CD164 antigen
Rat(83689) CD164 molecule, sialomucin
Zebrafish(555639) CD164 molecule, sialomucin
cow(509820) CD164 molecule, sialomucin
domestic cat(101082314) CD164 molecule, sialomucin
dog(475020) CD164 molecule, sialomucin
chicken(395380) CD164 molecule, sialomucin
domestic guinea pig(100714558) CD164 molecule, sialomucin
naked mole-rat(101701393) CD164 molecule, sialomucin
sheep(101114873) CD164 molecule, sialomucin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006016 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065691 MISSION® esiRNA esiRNA human CD164 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006016 Rosetta Predictions human pricing
NM_031812 Rosetta Predictions rat pricing
NM_016898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228925 predicted 648
2 SASI_Hs01_00228926 predicted 338
3 SASI_Hs01_00228927 predicted 536
4 SASI_Hs01_00228929 predicted 636
5 SASI_Hs01_00228930 predicted 427
6 SASI_Hs01_00228931 predicted 442
7 SASI_Hs01_00228933 predicted 424
8 SASI_Hs01_00228934 predicted 678
9 SASI_Hs02_00340733 predicted 522
10 SASI_Hs02_00340734 predicted 267
11 SASI_Hs01_00228928 predicted 696
12 SASI_Hs01_00228932 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044037 predicted 270
2 SASI_Rn01_00044038 predicted 593
3 SASI_Rn01_00044039 predicted 355
4 SASI_Rn01_00044040 predicted 622
5 SASI_Rn01_00044041 predicted 576
6 SASI_Rn01_00044042 predicted 598
7 SASI_Rn01_00044043 predicted 810
8 SASI_Rn01_00044044 predicted 879
9 SASI_Rn01_00044045 predicted 224
10 SASI_Rn01_00044046 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118936 predicted 605
2 SASI_Mm01_00118937 predicted 301
3 SASI_Mm01_00118938 predicted 650
4 SASI_Mm02_00323742 predicted 578
5 SASI_Mm01_00118939 predicted 384
6 SASI_Mm01_00118940 predicted 319
7 SASI_Mm01_00118941 predicted 442
8 SASI_Mm01_00118942 predicted 588
9 SASI_Mm01_00118943 predicted 789
10 SASI_Mm01_00118944 predicted 894
11 SASI_Mm01_00118935 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016898
VALIDATED
CD164 MISSION shRNA Bacterial Glycerol Stock
CD164 molecule, sialomucin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-232s21c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-386s21c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-345s21c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-578s21c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-2407s1c1
Sequence:CCGGCCCATATAAATGTCAGCATATCTCGAGATATGCTGACATTTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-578s1c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-345s1c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-232s1c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-386s1c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016898
VALIDATED
CD164 MISSION shRNA shRNA Plasmid DNA
CD164 molecule, sialomucin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-232s21c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-386s21c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-345s21c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-578s21c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-2407s1c1
Sequence:CCGGCCCATATAAATGTCAGCATATCTCGAGATATGCTGACATTTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-578s1c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-345s1c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-232s1c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-386s1c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016898
VALIDATED
CD164 MISSION shRNA Lentiviral Transduction Particles
CD164 molecule, sialomucin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-232s21c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-386s21c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-345s21c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016898.2-578s21c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-2407s1c1
Sequence:CCGGCCCATATAAATGTCAGCATATCTCGAGATATGCTGACATTTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-578s1c1
Sequence:CCGGCTTTCTCTATAAGTTCTGCAACTCGAGTTGCAGAACTTATAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-345s1c1
Sequence:CCGGCGCACTGACTTGTGTTCTGTACTCGAGTACAGAACACAAGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-232s1c1
Sequence:CCGGCCTGTGTTAATGCCACCTTTACTCGAGTAAAGGTGGCATTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016898.1-386s1c1
Sequence:CCGGGCCAACCAATTCTACAGCTAACTCGAGTTAGCTGTAGAATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006016
VALIDATED
CD164 MISSION shRNA Bacterial Glycerol Stock
CD164 molecule, sialomucin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-537s21c1
Sequence:CCGGCAGCCAATTCTACAGCTAAACCTCGAGGTTTAGCTGTAGAATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-702s21c1
Sequence:CCGGTGGGTGTGCAGGCTGTAATTTCTCGAGAAATTACAGCCTGCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-447s21c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-644s21c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-544s1c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-639s1c1
Sequence:CCGGCTGCAAATCTAAAGAACGAAACTCGAGTTTCGTTCTTTAGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-177s1c1
Sequence:CCGGCGTGACGACTTTAGCGCCCATCTCGAGATGGGCGCTAAAGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-395s1c1
Sequence:CCGGCGACAGACTTCTGTTCCGTTTCTCGAGAAACGGAACAGAAGTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-347s1c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006016
VALIDATED
CD164 MISSION shRNA shRNA Plasmid DNA
CD164 molecule, sialomucin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-537s21c1
Sequence:CCGGCAGCCAATTCTACAGCTAAACCTCGAGGTTTAGCTGTAGAATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-702s21c1
Sequence:CCGGTGGGTGTGCAGGCTGTAATTTCTCGAGAAATTACAGCCTGCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-447s21c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-644s21c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-544s1c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-639s1c1
Sequence:CCGGCTGCAAATCTAAAGAACGAAACTCGAGTTTCGTTCTTTAGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-177s1c1
Sequence:CCGGCGTGACGACTTTAGCGCCCATCTCGAGATGGGCGCTAAAGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-395s1c1
Sequence:CCGGCGACAGACTTCTGTTCCGTTTCTCGAGAAACGGAACAGAAGTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-347s1c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006016
VALIDATED
CD164 MISSION shRNA Lentiviral Transduction Particles
CD164 molecule, sialomucin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-537s21c1
Sequence:CCGGCAGCCAATTCTACAGCTAAACCTCGAGGTTTAGCTGTAGAATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-702s21c1
Sequence:CCGGTGGGTGTGCAGGCTGTAATTTCTCGAGAAATTACAGCCTGCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-447s21c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006016.4-644s21c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-544s1c1
Sequence:CCGGCCTGTGCGAAAGTCTACCTTTCTCGAGAAAGGTAGACTTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-639s1c1
Sequence:CCGGCTGCAAATCTAAAGAACGAAACTCGAGTTTCGTTCTTTAGATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-177s1c1
Sequence:CCGGCGTGACGACTTTAGCGCCCATCTCGAGATGGGCGCTAAAGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006016.3-395s1c1
Sequence:CCGGCGACAGACTTCTGTTCCGTTTCTCGAGAAACGGAACAGAAGTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006016.3-347s1c1
Sequence:CCGGGCTATTGTTCACATAACTCAACTCGAGTTGAGTTATGTGAACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks