EMAIL THIS PAGE TO A FRIEND

CD164L2

CD164 sialomucin-like 2

131 Gene Product Result for
Synonyms: UNQ6122
UniProtKB ID: Q6UWJ8, B2RPJ0, Q5JXD6
Gene ID:
Mouse(69655) CD164 sialomucin-like 2
Rat(689082) CD164 sialomucin-like 2
sheep(101113212) CD164 sialomucin-like 2
naked mole-rat(101700058) CD164 sialomucin-like 2
domestic guinea pig(100724107) CD164 sialomucin-like 2
Zebrafish(101883372) CD164 sialomucin-like 2
cow(539662) CD164 sialomucin-like 2
domestic cat(101082328) CD164 sialomucin-like 2
dog(612094) CD164 sialomucin-like 2
chicken(101748332) CD164 sialomucin-like 2
chicken(101665138) CD164 sialomucin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207397 Rosetta Predictions human pricing
XM_001069440 Rosetta Predictions rat pricing
NM_027152 Rosetta Predictions mouse pricing
XM_900160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100810 predicted 522
2 SASI_Hs01_00100811 predicted 1022
3 SASI_Hs01_00100812 predicted 705
4 SASI_Hs02_00374010 predicted 419
5 SASI_Hs01_00100813 predicted 936
6 SASI_Hs01_00100814 predicted 1090
7 SASI_Hs01_00100815 predicted 340
8 SASI_Hs01_00100816 predicted 579
9 SASI_Hs01_00100817 predicted 573
10 SASI_Hs01_00100818 predicted 265
11 SASI_Hs01_00100819 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328074 predicted 245
2 SASI_Rn02_00328075 predicted 177
3 SASI_Rn02_00328076 predicted 147
4 SASI_Rn02_00328077 predicted 139
5 SASI_Rn02_00328078 predicted 60
6 SASI_Rn02_00328079 predicted 197
7 SASI_Rn02_00328080 predicted 394
8 SASI_Rn02_00328081 predicted 106
9 SASI_Rn02_00328082 predicted 243
10 SASI_Rn02_00328083 predicted 152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331659 predicted 618
2 SASI_Mm02_00331660 predicted 245
3 SASI_Mm02_00331661 predicted 378
4 SASI_Mm02_00331662 predicted 663
5 SASI_Mm02_00331663 predicted 448
6 SASI_Mm02_00331664 predicted 437
7 SASI_Mm02_00331665 predicted 622
8 SASI_Mm02_00331666 predicted 482
9 SASI_Mm02_00331667 predicted 754
10 SASI_Mm02_00331668 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250956 predicted 818
2 SASI_Mm01_00250957 predicted 581
3 SASI_Mm01_00250958 predicted 656
4 SASI_Mm01_00250959 predicted 868
5 SASI_Mm01_00250960 predicted 650
6 SASI_Mm01_00250961 predicted 878
7 SASI_Mm01_00250962 predicted 1047
8 SASI_Mm01_00250963 predicted 1226
9 SASI_Mm01_00250964 predicted 1032
10 SASI_Mm01_00250965 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371239
CD164L2 MISSION shRNA Bacterial Glycerol Stock
CD164 sialomucin-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371239.2-925s1c1
Sequence:CCGGGCCTTGTGTCTAGTTGGGTTTCTCGAGAAACCCAACTAGACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-349s1c1
Sequence:CCGGCAAGGAAGGTTGCTCCATCTACTCGAGTAGATGGAGCAACCTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-271s1c1
Sequence:CCGGGCGCAATCTCTCCAGCTGCATCTCGAGATGCAGCTGGAGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-541s1c1
Sequence:CCGGGCTGCACTTCCTCAAGGCCAACTCGAGTTGGCCTTGAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-335s1c1
Sequence:CCGGCAATCTGAGGTGGTCAAGGAACTCGAGTTCCTTGACCACCTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371239
CD164L2 MISSION shRNA shRNA Plasmid DNA
CD164 sialomucin-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371239.2-925s1c1
Sequence:CCGGGCCTTGTGTCTAGTTGGGTTTCTCGAGAAACCCAACTAGACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-349s1c1
Sequence:CCGGCAAGGAAGGTTGCTCCATCTACTCGAGTAGATGGAGCAACCTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-271s1c1
Sequence:CCGGGCGCAATCTCTCCAGCTGCATCTCGAGATGCAGCTGGAGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-541s1c1
Sequence:CCGGGCTGCACTTCCTCAAGGCCAACTCGAGTTGGCCTTGAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-335s1c1
Sequence:CCGGCAATCTGAGGTGGTCAAGGAACTCGAGTTCCTTGACCACCTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371239
CD164L2 MISSION shRNA Lentiviral Transduction Particles
CD164 sialomucin-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371239.2-925s1c1
Sequence:CCGGGCCTTGTGTCTAGTTGGGTTTCTCGAGAAACCCAACTAGACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-349s1c1
Sequence:CCGGCAAGGAAGGTTGCTCCATCTACTCGAGTAGATGGAGCAACCTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-271s1c1
Sequence:CCGGGCGCAATCTCTCCAGCTGCATCTCGAGATGCAGCTGGAGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-541s1c1
Sequence:CCGGGCTGCACTTCCTCAAGGCCAACTCGAGTTGGCCTTGAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371239.2-335s1c1
Sequence:CCGGCAATCTGAGGTGGTCAAGGAACTCGAGTTCCTTGACCACCTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027152
CD164L2 MISSION shRNA Bacterial Glycerol Stock
CD164 sialomucin-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-245s21c1
Sequence:CCGGAGCTGGTTCTAGCTGGTAAAGCTCGAGCTTTACCAGCTAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-452s21c1
Sequence:CCGGAGGAGGGTTGCTCAATCTATACTCGAGTATAGATTGAGCAACCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-667s21c1
Sequence:CCGGAGCACTTACCAGACACTAATCCTCGAGGATTAGTGTCTGGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-368s21c1
Sequence:CCGGGAGCCCACAACTTCTCCATTTCTCGAGAAATGGAGAAGTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027152.1-724s21c1
Sequence:CCGGGAGGACCTCTTGGTTGCTTTACTCGAGTAAAGCAACCAAGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027152
CD164L2 MISSION shRNA shRNA Plasmid DNA
CD164 sialomucin-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-245s21c1
Sequence:CCGGAGCTGGTTCTAGCTGGTAAAGCTCGAGCTTTACCAGCTAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-452s21c1
Sequence:CCGGAGGAGGGTTGCTCAATCTATACTCGAGTATAGATTGAGCAACCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-667s21c1
Sequence:CCGGAGCACTTACCAGACACTAATCCTCGAGGATTAGTGTCTGGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-368s21c1
Sequence:CCGGGAGCCCACAACTTCTCCATTTCTCGAGAAATGGAGAAGTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027152.1-724s21c1
Sequence:CCGGGAGGACCTCTTGGTTGCTTTACTCGAGTAAAGCAACCAAGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027152
CD164L2 MISSION shRNA Lentiviral Transduction Particles
CD164 sialomucin-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-245s21c1
Sequence:CCGGAGCTGGTTCTAGCTGGTAAAGCTCGAGCTTTACCAGCTAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-452s21c1
Sequence:CCGGAGGAGGGTTGCTCAATCTATACTCGAGTATAGATTGAGCAACCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-667s21c1
Sequence:CCGGAGCACTTACCAGACACTAATCCTCGAGGATTAGTGTCTGGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027152.1-368s21c1
Sequence:CCGGGAGCCCACAACTTCTCCATTTCTCGAGAAATGGAGAAGTTGTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027152.1-724s21c1
Sequence:CCGGGAGGACCTCTTGGTTGCTTTACTCGAGTAAAGCAACCAAGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks