EMAIL THIS PAGE TO A FRIEND

CD177

CD177 molecule

161 Gene Product Result for
Synonyms: HNA-2a HNA2A NB1 NB1 GP PRV-1 PRV1
UniProtKB ID: Q8N6Q3, Q711Q2, Q8NCV9, Q96QH1, Q9HDA5
Gene ID:
Human(57126) Summary: NB1, a glycosyl-phosphatidylinositol (GPI)-linked N-glycosylated cell surface glycoprotein, was first described in a case of neonatal alloimmune neutropenia (Lalezari et al., 1971 [PubMed 5552408]
Mouse(68891) CD177 antigen
Rat(499099) CD177 molecule
cow(616350) CD177 molecule
dog(612424) CD177 molecule
sheep(101107126) CD177 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1401779 Anti-CD177 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411129 Anti-CD177 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA041820 Anti-CD177 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
HPA046601 Anti-CD177 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
WH0057126M1 Monoclonal Anti-CD177 antibody produced in mouse clone 4C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4700613 Monoclonal Anti-CD177 antibody produced in mouse clone MEM-166, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700614 Monoclonal Anti-CD177-APC antibody produced in mouse clone MEM-166, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700615 Monoclonal Anti-CD177-FITC antibody produced in mouse clone MEM-166, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700616 Monoclonal Anti-CD177-PE antibody produced in mouse clone MEM-166, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020406 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102161 MISSION® esiRNA esiRNA human CD177 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020406 Rosetta Predictions human pricing
XM_001076857 Rosetta Predictions rat pricing
XM_574390 Rosetta Predictions rat pricing
NM_026862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353391 predicted 631
2 SASI_Hs02_00353392 predicted 1084
3 SASI_Hs02_00353393 predicted 1410
4 SASI_Hs02_00353394 predicted 629
5 SASI_Hs02_00353395 predicted 725
6 SASI_Hs02_00353396 predicted 1420
7 SASI_Hs02_00353397 predicted 1450
8 SASI_Hs02_00353398 predicted 1196
9 SASI_Hs02_00353399 predicted 1089
10 SASI_Hs02_00353400 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354822 predicted 777
2 SASI_Rn02_00354823 predicted 203
3 SASI_Rn02_00354824 predicted 2836
4 SASI_Rn02_00354825 predicted 1869
5 SASI_Rn02_00354826 predicted 2207
6 SASI_Rn02_00354827 predicted 1404
7 SASI_Rn02_00354828 predicted 408
8 SASI_Rn02_00354829 predicted 650
9 SASI_Rn02_00354830 predicted 1145
10 SASI_Rn02_00354831 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401920 predicted 777
2 SASI_Rn02_00401921 predicted 207
3 SASI_Rn02_00401922 predicted 2256
4 SASI_Rn02_00401923 predicted 641
5 SASI_Rn02_00401924 predicted 1293
6 SASI_Rn02_00401925 predicted 1633
7 SASI_Rn02_00401926 predicted 416
8 SASI_Rn02_00401927 predicted 655
9 SASI_Rn02_00401928 predicted 1944
10 SASI_Rn02_00401929 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113345 predicted 1979
2 SASI_Mm01_00113346 predicted 2345
3 SASI_Mm01_00113347 predicted 812
4 SASI_Mm01_00113348 predicted 1973
5 SASI_Mm01_00113349 predicted 803
6 SASI_Mm01_00113350 predicted 653
7 SASI_Mm01_00113351 predicted 2410
8 SASI_Mm01_00113352 predicted 2345
9 SASI_Mm01_00113353 predicted 780
10 SASI_Mm01_00113354 predicted 2244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026862
CD177 MISSION shRNA Bacterial Glycerol Stock
CD177 molecule
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-600s21c1
Sequence:CCGGAGGCGATTGGGACCTTGTATACTCGAGTATACAAGGTCCCAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-758s21c1
Sequence:CCGGTATGAAACAGTGATGCTAATACTCGAGTATTAGCATCACTGTTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026862.3-2490s1c1
Sequence:CCGGTGACCATTCTTAATCCCTCTTCTCGAGAAGAGGGATTAAGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1208s1c1
Sequence:CCGGCTTCAGTTAGATGCTCTGAAACTCGAGTTTCAGAGCATCTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1880s1c1
Sequence:CCGGGCACCTGATGAGATTTGTCAACTCGAGTTGACAAATCTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-2141s1c1
Sequence:CCGGCCCATGTGTGTAGAGTTATTTCTCGAGAAATAACTCTACACACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-208s1c1
Sequence:CCGGGCTCCTGTATAATGGACCCAACTCGAGTTGGGTCCATTATACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026862
CD177 MISSION shRNA shRNA Plasmid DNA
CD177 molecule
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-600s21c1
Sequence:CCGGAGGCGATTGGGACCTTGTATACTCGAGTATACAAGGTCCCAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-758s21c1
Sequence:CCGGTATGAAACAGTGATGCTAATACTCGAGTATTAGCATCACTGTTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026862.3-2490s1c1
Sequence:CCGGTGACCATTCTTAATCCCTCTTCTCGAGAAGAGGGATTAAGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1208s1c1
Sequence:CCGGCTTCAGTTAGATGCTCTGAAACTCGAGTTTCAGAGCATCTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1880s1c1
Sequence:CCGGGCACCTGATGAGATTTGTCAACTCGAGTTGACAAATCTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-2141s1c1
Sequence:CCGGCCCATGTGTGTAGAGTTATTTCTCGAGAAATAACTCTACACACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-208s1c1
Sequence:CCGGGCTCCTGTATAATGGACCCAACTCGAGTTGGGTCCATTATACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026862
CD177 MISSION shRNA Lentiviral Transduction Particles
CD177 molecule
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-600s21c1
Sequence:CCGGAGGCGATTGGGACCTTGTATACTCGAGTATACAAGGTCCCAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026862.3-758s21c1
Sequence:CCGGTATGAAACAGTGATGCTAATACTCGAGTATTAGCATCACTGTTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026862.3-2490s1c1
Sequence:CCGGTGACCATTCTTAATCCCTCTTCTCGAGAAGAGGGATTAAGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1208s1c1
Sequence:CCGGCTTCAGTTAGATGCTCTGAAACTCGAGTTTCAGAGCATCTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-1880s1c1
Sequence:CCGGGCACCTGATGAGATTTGTCAACTCGAGTTGACAAATCTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-2141s1c1
Sequence:CCGGCCCATGTGTGTAGAGTTATTTCTCGAGAAATAACTCTACACACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026862.3-208s1c1
Sequence:CCGGGCTCCTGTATAATGGACCCAACTCGAGTTGGGTCCATTATACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020406
CD177 MISSION shRNA Bacterial Glycerol Stock
CD177 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-1343s21c1
Sequence:CCGGGCCCTTCCTGCTAACTCTATTCTCGAGAATAGAGTTAGCAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020406.2-1775s21c1
Sequence:CCGGGTGCTCCAGCCAAACGTATTTCTCGAGAAATACGTTTGGCTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-726s21c1
Sequence:CCGGTGATTGGACCACATCGAATACCTCGAGGTATTCGATGTGGTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-435s1c1
Sequence:CCGGCCAGTCTGCTTGTCTATGGAACTCGAGTTCCATAGACAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-201s1c1
Sequence:CCGGCAGGACACGTTGATGCTCATTCTCGAGAATGAGCATCAACGTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-596s1c1
Sequence:CCGGGCTCAATGGGACACAGGAAATCTCGAGATTTCCTGTGTCCCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-638s1c1
Sequence:CCGGGAACTGCAATAGGAAAGATTTCTCGAGAAATCTTTCCTATTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-1175s1c1
Sequence:CCGGGTTGAACCACACCAGACAAATCTCGAGATTTGTCTGGTGTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-682s1c1
Sequence:CCGGCCATTATGACACACGGAAACTCTCGAGAGTTTCCGTGTGTCATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020406
CD177 MISSION shRNA shRNA Plasmid DNA
CD177 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-1343s21c1
Sequence:CCGGGCCCTTCCTGCTAACTCTATTCTCGAGAATAGAGTTAGCAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020406.2-1775s21c1
Sequence:CCGGGTGCTCCAGCCAAACGTATTTCTCGAGAAATACGTTTGGCTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-726s21c1
Sequence:CCGGTGATTGGACCACATCGAATACCTCGAGGTATTCGATGTGGTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-435s1c1
Sequence:CCGGCCAGTCTGCTTGTCTATGGAACTCGAGTTCCATAGACAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-201s1c1
Sequence:CCGGCAGGACACGTTGATGCTCATTCTCGAGAATGAGCATCAACGTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-596s1c1
Sequence:CCGGGCTCAATGGGACACAGGAAATCTCGAGATTTCCTGTGTCCCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-638s1c1
Sequence:CCGGGAACTGCAATAGGAAAGATTTCTCGAGAAATCTTTCCTATTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-1175s1c1
Sequence:CCGGGTTGAACCACACCAGACAAATCTCGAGATTTGTCTGGTGTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-682s1c1
Sequence:CCGGCCATTATGACACACGGAAACTCTCGAGAGTTTCCGTGTGTCATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020406
CD177 MISSION shRNA Lentiviral Transduction Particles
CD177 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-1343s21c1
Sequence:CCGGGCCCTTCCTGCTAACTCTATTCTCGAGAATAGAGTTAGCAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020406.2-1775s21c1
Sequence:CCGGGTGCTCCAGCCAAACGTATTTCTCGAGAAATACGTTTGGCTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020406.2-726s21c1
Sequence:CCGGTGATTGGACCACATCGAATACCTCGAGGTATTCGATGTGGTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-435s1c1
Sequence:CCGGCCAGTCTGCTTGTCTATGGAACTCGAGTTCCATAGACAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-201s1c1
Sequence:CCGGCAGGACACGTTGATGCTCATTCTCGAGAATGAGCATCAACGTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-596s1c1
Sequence:CCGGGCTCAATGGGACACAGGAAATCTCGAGATTTCCTGTGTCCCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-638s1c1
Sequence:CCGGGAACTGCAATAGGAAAGATTTCTCGAGAAATCTTTCCTATTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-1175s1c1
Sequence:CCGGGTTGAACCACACCAGACAAATCTCGAGATTTGTCTGGTGTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020406.1-682s1c1
Sequence:CCGGCCATTATGACACACGGAAACTCTCGAGAGTTTCCGTGTGTCATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks