EMAIL THIS PAGE TO A FRIEND

CD180

CD180 molecule

61 Gene Product Result for
Synonyms: LY64 Ly78 RP105
UniProtKB ID: Q99467, B2R7Z7, Q32MM5
Gene ID:
Human(4064) Summary: CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
Mouse(17079) CD180 antigen
Rat(294706) CD180 molecule
sheep(101122054) CD180 molecule
naked mole-rat(101705245) CD180 molecule
chicken(431584) CD180 molecule
dog(487234) CD180 molecule
domestic cat(101085598) CD180 molecule
cow(539518) CD180 molecule
Horse(100056598) CD180 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047391 MISSION® esiRNA esiRNA human CD180 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005582 Rosetta Predictions human pricing
NM_001106405 Rosetta Predictions rat pricing
NM_008533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339866 predicted 1251
2 SASI_Hs02_00339867 predicted 1338
3 SASI_Hs01_00105190 predicted 1441
4 SASI_Hs01_00105191 predicted 837
5 SASI_Hs01_00105192 predicted 1059
6 SASI_Hs01_00105193 predicted 1984
7 SASI_Hs01_00105195 predicted 1279
8 SASI_Hs01_00105196 predicted 1147
9 SASI_Hs02_00339868 predicted 1848
10 SASI_Hs02_00339869 predicted 1781
11 SASI_Hs01_00105187 predicted 1887
12 SASI_Hs01_00105188 predicted 759
13 SASI_Hs01_00105189 predicted 1749
14 SASI_Hs01_00105194 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218638 predicted 380
2 SASI_Rn02_00218639 predicted 1258
3 SASI_Rn02_00218640 predicted 523
4 SASI_Rn02_00218641 predicted 1133
5 SASI_Rn02_00218642 predicted 224
6 SASI_Rn02_00218643 predicted 567
7 SASI_Rn02_00218644 predicted 424
8 SASI_Rn02_00218645 predicted 1729
9 SASI_Rn02_00218646 predicted 594
10 SASI_Rn02_00218647 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022496 predicted 402
2 SASI_Mm01_00022497 predicted 1093
3 SASI_Mm01_00022498 predicted 1151
4 SASI_Mm01_00022500 predicted 1868
5 SASI_Mm01_00022501 predicted 544
6 SASI_Mm01_00022502 predicted 498
7 SASI_Mm01_00022503 predicted 1745
8 SASI_Mm01_00022504 predicted 1847
9 SASI_Mm01_00022505 predicted 442
10 SASI_Mm02_00314125 predicted 925
11 SASI_Mm01_00022499 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005582
CD180 MISSION shRNA Bacterial Glycerol Stock
CD180 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-922s1c1
Sequence:CCGGCGAAGATATTAGTTCAGCCATCTCGAGATGGCTGAACTAATATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-1401s1c1
Sequence:CCGGCTCAGCTAGAACTCCTCGATTCTCGAGAATCGAGGAGTTCTAGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-751s1c1
Sequence:CCGGCCTGAACTTCAATGGCAATAACTCGAGTTATTGCCATTGAAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-2105s1c1
Sequence:CCGGAGGTGGAAATACCAACACATTCTCGAGAATGTGTTGGTATTTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-477s1c1
Sequence:CCGGCCCTGATATTCATGGCAGAAACTCGAGTTTCTGCCATGAATATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-398s21c1
Sequence:CCGGTTAACTAGGTGCCAGATTAACCTCGAGGTTAATCTGGCACCTAGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1886s21c1
Sequence:CCGGGACTGCACTTGCTCGAATATTCTCGAGAATATTCGAGCAAGTGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1558s21c1
Sequence:CCGGTCTCCGGCATCTCAACTTAAACTCGAGTTTAAGTTGAGATGCCGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005582
CD180 MISSION shRNA shRNA Plasmid DNA
CD180 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-922s1c1
Sequence:CCGGCGAAGATATTAGTTCAGCCATCTCGAGATGGCTGAACTAATATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-1401s1c1
Sequence:CCGGCTCAGCTAGAACTCCTCGATTCTCGAGAATCGAGGAGTTCTAGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-751s1c1
Sequence:CCGGCCTGAACTTCAATGGCAATAACTCGAGTTATTGCCATTGAAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-2105s1c1
Sequence:CCGGAGGTGGAAATACCAACACATTCTCGAGAATGTGTTGGTATTTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-477s1c1
Sequence:CCGGCCCTGATATTCATGGCAGAAACTCGAGTTTCTGCCATGAATATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-398s21c1
Sequence:CCGGTTAACTAGGTGCCAGATTAACCTCGAGGTTAATCTGGCACCTAGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1886s21c1
Sequence:CCGGGACTGCACTTGCTCGAATATTCTCGAGAATATTCGAGCAAGTGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1558s21c1
Sequence:CCGGTCTCCGGCATCTCAACTTAAACTCGAGTTTAAGTTGAGATGCCGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005582
CD180 MISSION shRNA Lentiviral Transduction Particles
CD180 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-922s1c1
Sequence:CCGGCGAAGATATTAGTTCAGCCATCTCGAGATGGCTGAACTAATATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-1401s1c1
Sequence:CCGGCTCAGCTAGAACTCCTCGATTCTCGAGAATCGAGGAGTTCTAGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-751s1c1
Sequence:CCGGCCTGAACTTCAATGGCAATAACTCGAGTTATTGCCATTGAAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-2105s1c1
Sequence:CCGGAGGTGGAAATACCAACACATTCTCGAGAATGTGTTGGTATTTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005582.1-477s1c1
Sequence:CCGGCCCTGATATTCATGGCAGAAACTCGAGTTTCTGCCATGAATATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-398s21c1
Sequence:CCGGTTAACTAGGTGCCAGATTAACCTCGAGGTTAATCTGGCACCTAGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1886s21c1
Sequence:CCGGGACTGCACTTGCTCGAATATTCTCGAGAATATTCGAGCAAGTGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005582.2-1558s21c1
Sequence:CCGGTCTCCGGCATCTCAACTTAAACTCGAGTTTAAGTTGAGATGCCGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008533
CD180 MISSION shRNA Bacterial Glycerol Stock
CD180 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008533.1-2118s1c1
Sequence:CCGGGCAGATAAATGTGTTTAGCAACTCGAGTTGCTAAACACATTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-817s1c1
Sequence:CCGGGCTAGTTATCTTCAAGGGTTTCTCGAGAAACCCTTGAAGATAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-662s1c1
Sequence:CCGGGCTATCCATTACCTGTCTAAACTCGAGTTTAGACAGGTAATGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1529s1c1
Sequence:CCGGCATTTGAACTTACAGGGAAATCTCGAGATTTCCCTGTAAGTTCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1528s1c1
Sequence:CCGGGCATTTGAACTTACAGGGAAACTCGAGTTTCCCTGTAAGTTCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008533
CD180 MISSION shRNA shRNA Plasmid DNA
CD180 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008533.1-2118s1c1
Sequence:CCGGGCAGATAAATGTGTTTAGCAACTCGAGTTGCTAAACACATTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-817s1c1
Sequence:CCGGGCTAGTTATCTTCAAGGGTTTCTCGAGAAACCCTTGAAGATAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-662s1c1
Sequence:CCGGGCTATCCATTACCTGTCTAAACTCGAGTTTAGACAGGTAATGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1529s1c1
Sequence:CCGGCATTTGAACTTACAGGGAAATCTCGAGATTTCCCTGTAAGTTCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1528s1c1
Sequence:CCGGGCATTTGAACTTACAGGGAAACTCGAGTTTCCCTGTAAGTTCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008533
CD180 MISSION shRNA Lentiviral Transduction Particles
CD180 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008533.1-2118s1c1
Sequence:CCGGGCAGATAAATGTGTTTAGCAACTCGAGTTGCTAAACACATTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-817s1c1
Sequence:CCGGGCTAGTTATCTTCAAGGGTTTCTCGAGAAACCCTTGAAGATAACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-662s1c1
Sequence:CCGGGCTATCCATTACCTGTCTAAACTCGAGTTTAGACAGGTAATGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1529s1c1
Sequence:CCGGCATTTGAACTTACAGGGAAATCTCGAGATTTCCCTGTAAGTTCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008533.1-1528s1c1
Sequence:CCGGGCATTTGAACTTACAGGGAAACTCGAGTTTCCCTGTAAGTTCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)