EMAIL THIS PAGE TO A FRIEND

CD19

CD19 molecule

98 Gene Product Result for
Synonyms: B4 CVID3
UniProtKB ID: P15391, A0N0P9, F5H635, Q96S68, Q9BRD6
Gene ID:
Human(930) Summary: Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008]
Mouse(12478) CD19 antigen
Rat(365367) CD19 molecule
Horse(100147468) CD19 molecule
cow(517359) CD19 molecule
domestic cat(100125860) CD19 molecule
dog(607898) CD19 molecule
sheep(101111510) CD19 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104897 Anti-CD19 (416-430) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1104898 Anti-CD19 (521-535) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
GW23003 Anti-CD19 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5500047 Anti-CD19 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP110, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4503617 Anti-CD19, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4503858 Anti-phospho-CD19 (pTyr531) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301410 Anti-phospho-CD19 (pTyr531) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
WH0000930M1 Monoclonal Anti-CD19 antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403645 Monoclonal Anti-CD19 antibody produced in mouse clone 1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700108 Monoclonal Anti-CD19 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700109 Monoclonal Anti-CD19 antibody produced in mouse clone LT19, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700549 Monoclonal Anti-Cd19 low endotoxin antibody produced in rat clone 1D3, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700110 Monoclonal Anti-CD19-APC antibody produced in mouse clone LT19, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700717 Monoclonal Anti-CD19-APC antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry pricing
SAB4700111 Monoclonal Anti-CD19-Biotin antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700112 Monoclonal Anti-CD19-FITC antibody produced in mouse clone LT19, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700704 Monoclonal Anti-CD19-FITC antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry pricing
F3899 Monoclonal Anti-CD19−FITC antibody produced in mouse clone SJ25-C1, purified immunoglobulin, buffered aqueous solution flow cytometry pricing
SAB4700113 Monoclonal Anti-CD19-PE antibody produced in mouse clone LT19, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700683 Monoclonal Anti-CD19-PE antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry pricing
P7437 Monoclonal Anti-CD19−PE antibody produced in mouse clone SJ25-C1, purified immunoglobulin, buffered aqueous solution flow cytometry pricing
SAB4700550 Monoclonal Anti-Cd19-PE antibody produced in rat clone 1D3, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF164B Anti-CD19 Antibody, APC Conjugated, (human), clone SJ25C1 25 tests, This mouse monoclonal, Anti-CD19 (human), APC, clone SJ25C1, Cat. No. MABF1644 is validated for use in Flow Cytometry, for the detection of CD19. pricing
CBL582 Anti-CD19 Antibody, clone HD37 100 µg, Anti-CD19 Antibody, clone HD37 detects level of CD19 & has been published & validated for use in FC, IP, IH. pricing
MABF1647 Anti-CD19 Antibody, FITC Conjugated, (human), clone SJ25C1 25 tests, This mouse monoclonal Anti-CD19 (human), FITC, clone SJ25C1, Cat. No. MABF1647 is validated for use in Flow Cytometry, for the detection of CD19. pricing
MABF165A Anti-CD19 (human), PE, clone SJ25C1 Antibody 100 tests, This Anti-CD19 antibody (human), PE, clone SJ25C1 is validated for use in Flow Cytometry for the detection of CD19. pricing
MABF197 Anti-CD19 (mouse), APC, clone 6D5 Antibody 100 µg, Anti-CD19 antibody (mouse), APC, clone 6D5 is a highly specific rat monoclonal antibody & that targets CD19 & has been tested in Flow Cytometry. pricing
MABF311 Anti-CD19 (mouse), PE, clone 6D5 Antibody 200 µg, Anti-CD19 antibody (mouse), PE, clone 6D5 is a highly specific rat monoclonal antibody & that targets CD19 & has been tested in Flow Cytometry. pricing
MABF312 Anti-CD19 (mouse), PE/Cy5, clone 6D5 Antibody 100 µg, Anti-CD19 antibody (mouse), PE/Cy5, clone 6D5 is a highly specific rat monoclonal antibody & that targets CD19 & has been tested in Flow Cytometry. pricing
MAB1794 Anti-Human B cells (CD19) Antibody, clone FMC63 100 µg, This Anti-Human B cells CD19 Antibody, clone FMC63 is validated for use in FC, IF for the detection of CD19. pricing
MAB1794H Anti-Human B cells (CD19) Antibody, clone FMC63, Phycoerythrin conjugated 100 assays, Detect CD19 using this Anti-Human B cells (CD19) Antibody, clone FMC63, Phycoerythrin conjugated validated for use in FC. pricing
FCMAB218F Milli-Mark® Anti-CD19-FITC Antibody, clone 6D5 100 tests, Detect CD19 using this Milli-Mark Anti-CD19-FITC Antibody, clone 6D5 validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001770 Rosetta Predictions human pricing
NM_001013237 Rosetta Predictions rat pricing
NM_009844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167726 predicted 1560
2 SASI_Hs01_00167727 predicted 1554
3 SASI_Hs01_00167728 predicted 817
4 SASI_Hs01_00167729 predicted 1301
5 SASI_Hs01_00167730 predicted 762
6 SASI_Hs01_00167731 predicted 873
7 SASI_Hs01_00167732 predicted 815
8 SASI_Hs01_00167733 predicted 739
9 SASI_Hs02_00332513 predicted 718
10 SASI_Hs02_00332514 predicted 968
11 SASI_Hs01_00167734 predicted 525
12 SASI_Hs01_00167735 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201049 predicted 1150
2 SASI_Rn02_00201050 predicted 827
3 SASI_Rn02_00201051 predicted 681
4 SASI_Rn02_00201052 predicted 905
5 SASI_Rn02_00201053 predicted 482
6 SASI_Rn02_00201054 predicted 269
7 SASI_Rn02_00201055 predicted 675
8 SASI_Rn02_00201056 predicted 1280
9 SASI_Rn02_00201057 predicted 693
10 SASI_Rn02_00201058 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098003 predicted 792
2 SASI_Mm01_00098004 predicted 1604
3 SASI_Mm01_00098005 predicted 557
4 SASI_Mm01_00098006 predicted 680
5 SASI_Mm01_00098007 predicted 1149
6 SASI_Mm01_00098008 predicted 1703
7 SASI_Mm01_00098010 predicted 1508
8 SASI_Mm01_00098011 predicted 564
9 SASI_Mm01_00098012 predicted 781
10 SASI_Mm02_00317214 predicted 1373
11 SASI_Mm01_00098009 predicted 1325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001770
CD19 MISSION shRNA Bacterial Glycerol Stock
CD19 molecule
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001770.4-821s21c1
Sequence:CCGGTCAAGACGCTGGAAAGTATTACTCGAGTAATACTTTCCAGCGTCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1297s1c1
Sequence:CCGGCCGAGTTCTATGAGAACGACTCTCGAGAGTCGTTCTCATAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-296s1c1
Sequence:CCGGCTTCAACGTCTCTCAACAGATCTCGAGATCTGTTGAGAGACGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-708s1c1
Sequence:CCGGCCTAAGTCATTGCTGAGCCTACTCGAGTAGGCTCAGCAATGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1412s1c1
Sequence:CCGGCAACGCTGAGTCTTATGAGAACTCGAGTTCTCATAAGACTCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-967s1c1
Sequence:CCGGTGGGCATTCTTCATCTTCAAACTCGAGTTTGAAGATGAAGAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001770
CD19 MISSION shRNA shRNA Plasmid DNA
CD19 molecule
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001770.4-821s21c1
Sequence:CCGGTCAAGACGCTGGAAAGTATTACTCGAGTAATACTTTCCAGCGTCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1297s1c1
Sequence:CCGGCCGAGTTCTATGAGAACGACTCTCGAGAGTCGTTCTCATAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-296s1c1
Sequence:CCGGCTTCAACGTCTCTCAACAGATCTCGAGATCTGTTGAGAGACGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-708s1c1
Sequence:CCGGCCTAAGTCATTGCTGAGCCTACTCGAGTAGGCTCAGCAATGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1412s1c1
Sequence:CCGGCAACGCTGAGTCTTATGAGAACTCGAGTTCTCATAAGACTCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-967s1c1
Sequence:CCGGTGGGCATTCTTCATCTTCAAACTCGAGTTTGAAGATGAAGAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001770
CD19 MISSION shRNA Lentiviral Transduction Particles
CD19 molecule
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001770.4-821s21c1
Sequence:CCGGTCAAGACGCTGGAAAGTATTACTCGAGTAATACTTTCCAGCGTCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1297s1c1
Sequence:CCGGCCGAGTTCTATGAGAACGACTCTCGAGAGTCGTTCTCATAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-296s1c1
Sequence:CCGGCTTCAACGTCTCTCAACAGATCTCGAGATCTGTTGAGAGACGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-708s1c1
Sequence:CCGGCCTAAGTCATTGCTGAGCCTACTCGAGTAGGCTCAGCAATGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-1412s1c1
Sequence:CCGGCAACGCTGAGTCTTATGAGAACTCGAGTTCTCATAAGACTCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001770.3-967s1c1
Sequence:CCGGTGGGCATTCTTCATCTTCAAACTCGAGTTTGAAGATGAAGAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009844
CD19 MISSION shRNA Bacterial Glycerol Stock
CD19 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-767s1c1
Sequence:CCGGCCTATTATTGTCTCCGAGGAACTCGAGTTCCTCGGAGACAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1346s1c1
Sequence:CCGGCCAATGCTGAGTCTTATGAAACTCGAGTTTCATAAGACTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-871s1c1
Sequence:CCGGCCAGTGGTGACTTTAGTATATCTCGAGATATACTAAAGTCACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-28s1c1
Sequence:CCGGCTCCTCTTTCTTACCTTAGTACTCGAGTACTAAGGTAAGAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1136s1c1
Sequence:CCGGCACGCATTCAAGTCCAGGATACTCGAGTATCCTGGACTTGAATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009844
CD19 MISSION shRNA shRNA Plasmid DNA
CD19 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-767s1c1
Sequence:CCGGCCTATTATTGTCTCCGAGGAACTCGAGTTCCTCGGAGACAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1346s1c1
Sequence:CCGGCCAATGCTGAGTCTTATGAAACTCGAGTTTCATAAGACTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-871s1c1
Sequence:CCGGCCAGTGGTGACTTTAGTATATCTCGAGATATACTAAAGTCACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-28s1c1
Sequence:CCGGCTCCTCTTTCTTACCTTAGTACTCGAGTACTAAGGTAAGAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1136s1c1
Sequence:CCGGCACGCATTCAAGTCCAGGATACTCGAGTATCCTGGACTTGAATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009844
CD19 MISSION shRNA Lentiviral Transduction Particles
CD19 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-767s1c1
Sequence:CCGGCCTATTATTGTCTCCGAGGAACTCGAGTTCCTCGGAGACAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1346s1c1
Sequence:CCGGCCAATGCTGAGTCTTATGAAACTCGAGTTTCATAAGACTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-871s1c1
Sequence:CCGGCCAGTGGTGACTTTAGTATATCTCGAGATATACTAAAGTCACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-28s1c1
Sequence:CCGGCTCCTCTTTCTTACCTTAGTACTCGAGTACTAAGGTAAGAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009844.1-1136s1c1
Sequence:CCGGCACGCATTCAAGTCCAGGATACTCGAGTATCCTGGACTTGAATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks