EMAIL THIS PAGE TO A FRIEND

CD1A

CD1a molecule

28 Gene Product Result for
Synonyms: CD1 FCB6 HTA1 R4 T6
UniProtKB ID: P06126, D3DVD7, Q13962, Q5TDJ8, Q9UMM4, Q9Y5M5
Gene ID:
Human(909) Summary: This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
sheep(101111409) CD1a molecule
cow(782023) CD1a molecule
cow(781011) CD1a molecule
dog(610699) CD1a molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001763 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078881 MISSION® esiRNA esiRNA human CD1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001763 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227809 predicted 693
2 SASI_Hs01_00227810 predicted 804
3 SASI_Hs01_00227811 predicted 1447
4 SASI_Hs01_00227812 predicted 1022
5 SASI_Hs02_00332492 predicted 911
6 SASI_Hs01_00227813 predicted 996
7 SASI_Hs02_00332493 predicted 925
8 SASI_Hs01_00227815 predicted 1075
9 SASI_Hs01_00227816 predicted 1090
10 SASI_Hs01_00227817 predicted 834
11 SASI_Hs01_00227814 predicted 987
12 SASI_Hs01_00227818 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001763
VALIDATED
CD1A MISSION shRNA Bacterial Glycerol Stock
CD1a molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-1449s1c1
Sequence:CCGGGCGGTGATAGTGCCTTTACTTCTCGAGAAGTAAAGGCACTATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-838s1c1
Sequence:CCGGCCCATGAATTGCAGTTTGAATCTCGAGATTCAAACTGCAATTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-678s1c1
Sequence:CCGGCTGAGTGATTTGCAGACTCATCTCGAGATGAGTCTGCAAATCACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1027s1c1
Sequence:CCGGTCAATCAGAATCAGCATGAAACTCGAGTTTCATGCTGATTCTGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1086s1c1
Sequence:CCGGCGTTTCATCTTGGGTCTTCTTCTCGAGAAGAAGACCCAAGATGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-918s21c1
Sequence:CCGGAGCTTCTTGCAGTTAGCTTATCTCGAGATAAGCTAACTGCAAGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-1491s21c1
Sequence:CCGGTGGTTCAGGAAACGCTGTTTCCTCGAGGAAACAGCGTTTCCTGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001763
VALIDATED
CD1A MISSION shRNA shRNA Plasmid DNA
CD1a molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-1449s1c1
Sequence:CCGGGCGGTGATAGTGCCTTTACTTCTCGAGAAGTAAAGGCACTATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-838s1c1
Sequence:CCGGCCCATGAATTGCAGTTTGAATCTCGAGATTCAAACTGCAATTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-678s1c1
Sequence:CCGGCTGAGTGATTTGCAGACTCATCTCGAGATGAGTCTGCAAATCACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1027s1c1
Sequence:CCGGTCAATCAGAATCAGCATGAAACTCGAGTTTCATGCTGATTCTGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1086s1c1
Sequence:CCGGCGTTTCATCTTGGGTCTTCTTCTCGAGAAGAAGACCCAAGATGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-918s21c1
Sequence:CCGGAGCTTCTTGCAGTTAGCTTATCTCGAGATAAGCTAACTGCAAGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-1491s21c1
Sequence:CCGGTGGTTCAGGAAACGCTGTTTCCTCGAGGAAACAGCGTTTCCTGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001763
VALIDATED
CD1A MISSION shRNA Lentiviral Transduction Particles
CD1a molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-1449s1c1
Sequence:CCGGGCGGTGATAGTGCCTTTACTTCTCGAGAAGTAAAGGCACTATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001763.1-838s1c1
Sequence:CCGGCCCATGAATTGCAGTTTGAATCTCGAGATTCAAACTGCAATTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-678s1c1
Sequence:CCGGCTGAGTGATTTGCAGACTCATCTCGAGATGAGTCTGCAAATCACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1027s1c1
Sequence:CCGGTCAATCAGAATCAGCATGAAACTCGAGTTTCATGCTGATTCTGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001763.1-1086s1c1
Sequence:CCGGCGTTTCATCTTGGGTCTTCTTCTCGAGAAGAAGACCCAAGATGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-918s21c1
Sequence:CCGGAGCTTCTTGCAGTTAGCTTATCTCGAGATAAGCTAACTGCAAGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001763.2-1491s21c1
Sequence:CCGGTGGTTCAGGAAACGCTGTTTCCTCGAGGAAACAGCGTTTCCTGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)