EMAIL THIS PAGE TO A FRIEND

CD1B

CD1b molecule

47 Gene Product Result for
Synonyms: CD1 CD1A R1
UniProtKB ID: P29016, Q5TDK9, Q5TDL0, Q9UMM2
Gene ID:
Human(910) Summary: This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens. [provided by RefSeq, Jul 2008]
chicken(425802) CD1b molecule
Horse(100034038) CD1b molecule
cow(509004) CD1b molecule
dog(100174779) CD1b molecule
sheep(443423) CD1b molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029431 MISSION® esiRNA esiRNA human CD1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001764 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242930 predicted 591
2 SASI_Hs01_00242933 predicted 453
3 SASI_Hs01_00242934 predicted 617
4 SASI_Hs01_00242935 predicted 380
5 SASI_Hs01_00242936 predicted 505
6 SASI_Hs02_00332494 predicted 212
7 SASI_Hs01_00242938 predicted 280
8 SASI_Hs02_00332495 predicted 435
9 SASI_Hs01_00242939 predicted 307
10 SASI_Hs02_00332496 predicted 319
11 SASI_Hs01_00242931 predicted 567
12 SASI_Hs01_00242932 predicted 525
13 SASI_Hs01_00242937 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001764
CD1B MISSION shRNA Bacterial Glycerol Stock
CD1b molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-1059s21c1
Sequence:CCGGATGCCTTGCATTATGGTATATCTCGAGATATACCATAATGCAAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-405s21c1
Sequence:CCGGACAAGACTTTGCCGGTGATTTCTCGAGAAATCACCGGCAAAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001764.2-1125s21c1
Sequence:CCGGTCCTCTCCCATTCGCAATAAGCTCGAGCTTATTGCGAATGGGAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-309s1c1
Sequence:CCGGCCGAGTCTACATCTTTGGATTCTCGAGAATCCAAAGATGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-143s1c1
Sequence:CCGGCCTCGTCCTTTACCAATAGTACTCGAGTACTATTGGTAAAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-520s1c1
Sequence:CCGGGCACAGAAATTCTGTGCACTACTCGAGTAGTGCACAGAATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-117s1c1
Sequence:CCGGGCCGACCTCCTTTCATGTTATCTCGAGATAACATGAAAGGAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-253s1c1
Sequence:CCGGCCTTGGTCTAAAGGTAACTTTCTCGAGAAAGTTACCTTTAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001764
CD1B MISSION shRNA shRNA Plasmid DNA
CD1b molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-1059s21c1
Sequence:CCGGATGCCTTGCATTATGGTATATCTCGAGATATACCATAATGCAAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-405s21c1
Sequence:CCGGACAAGACTTTGCCGGTGATTTCTCGAGAAATCACCGGCAAAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001764.2-1125s21c1
Sequence:CCGGTCCTCTCCCATTCGCAATAAGCTCGAGCTTATTGCGAATGGGAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-309s1c1
Sequence:CCGGCCGAGTCTACATCTTTGGATTCTCGAGAATCCAAAGATGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-143s1c1
Sequence:CCGGCCTCGTCCTTTACCAATAGTACTCGAGTACTATTGGTAAAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-520s1c1
Sequence:CCGGGCACAGAAATTCTGTGCACTACTCGAGTAGTGCACAGAATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-117s1c1
Sequence:CCGGGCCGACCTCCTTTCATGTTATCTCGAGATAACATGAAAGGAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-253s1c1
Sequence:CCGGCCTTGGTCTAAAGGTAACTTTCTCGAGAAAGTTACCTTTAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001764
CD1B MISSION shRNA Lentiviral Transduction Particles
CD1b molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-1059s21c1
Sequence:CCGGATGCCTTGCATTATGGTATATCTCGAGATATACCATAATGCAAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001764.2-405s21c1
Sequence:CCGGACAAGACTTTGCCGGTGATTTCTCGAGAAATCACCGGCAAAGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001764.2-1125s21c1
Sequence:CCGGTCCTCTCCCATTCGCAATAAGCTCGAGCTTATTGCGAATGGGAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-309s1c1
Sequence:CCGGCCGAGTCTACATCTTTGGATTCTCGAGAATCCAAAGATGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-143s1c1
Sequence:CCGGCCTCGTCCTTTACCAATAGTACTCGAGTACTATTGGTAAAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-520s1c1
Sequence:CCGGGCACAGAAATTCTGTGCACTACTCGAGTAGTGCACAGAATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-117s1c1
Sequence:CCGGGCCGACCTCCTTTCATGTTATCTCGAGATAACATGAAAGGAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001764.1-253s1c1
Sequence:CCGGCCTTGGTCTAAAGGTAACTTTCTCGAGAAAGTTACCTTTAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks