EMAIL THIS PAGE TO A FRIEND

CD1C

CD1c molecule

107 Gene Product Result for
Synonyms: BDCA1 CD1 CD1A R7
UniProtKB ID: P29017, Q5TDJ7, Q6IAS4, Q9UMM0, Q9UN96
Gene ID:
Human(911) Summary: This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene is broadly distributed throughout the endocytic system via a tyrosine-based motif in the cytoplasmic tail. Alternatively spliced transcript variants of this gene have been observed, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
chicken(425801) CD1c molecule
cow(100141145) CD1c molecule
Horse(100056353) CD1c molecule
domestic cat(101080762) CD1c molecule
dog(488609) CD1c molecule
sheep(101116198) CD1c molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001765 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021081 MISSION® esiRNA esiRNA human CD1C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001765 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011658 predicted 701
2 SASI_Hs01_00011659 predicted 813
3 SASI_Hs01_00011661 predicted 713
4 SASI_Hs02_00332497 predicted 623
5 SASI_Hs01_00011662 predicted 596
6 SASI_Hs02_00332498 predicted 382
7 SASI_Hs01_00011663 predicted 768
8 SASI_Hs01_00011664 predicted 818
9 SASI_Hs02_00332499 predicted 802
10 SASI_Hs02_00332500 predicted 690
11 SASI_Hs01_00011660 predicted 232
12 SASI_Hs01_00011665 predicted 375
13 SASI_Hs01_00011666 predicted 541
14 SASI_Hs01_00011667 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001765
CD1C MISSION shRNA Bacterial Glycerol Stock
CD1c molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-462s1c1
Sequence:CCGGCGGATTAGATTTACTGAGTTTCTCGAGAAACTCAGTAAATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-300s1c1
Sequence:CCGGCCTAGAGTTGTTATTTCGTTTCTCGAGAAACGAAATAACAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-1026s1c1
Sequence:CCGGGCACTGCTCATATCAGGACATCTCGAGATGTCCTGATATGAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-358s1c1
Sequence:CCGGGCAAGTCAAGATTACTCGAAACTCGAGTTTCGAGTAATCTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-566s1c1
Sequence:CCGGGCGTCACAGAAACAGTGTATACTCGAGTATACACTGTTTCTGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-570s21c1
Sequence:CCGGTTGGATTAACTCGGGAGATTCCTCGAGGAATCTCCCGAGTTAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-1035s21c1
Sequence:CCGGGCACTAAACATGGTGATATTCCTCGAGGAATATCACCATGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-469s21c1
Sequence:CCGGCAGTGAATCAGGCACAATAATCTCGAGATTATTGTGCCTGATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001765
CD1C MISSION shRNA shRNA Plasmid DNA
CD1c molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-462s1c1
Sequence:CCGGCGGATTAGATTTACTGAGTTTCTCGAGAAACTCAGTAAATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-300s1c1
Sequence:CCGGCCTAGAGTTGTTATTTCGTTTCTCGAGAAACGAAATAACAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-1026s1c1
Sequence:CCGGGCACTGCTCATATCAGGACATCTCGAGATGTCCTGATATGAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-358s1c1
Sequence:CCGGGCAAGTCAAGATTACTCGAAACTCGAGTTTCGAGTAATCTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-566s1c1
Sequence:CCGGGCGTCACAGAAACAGTGTATACTCGAGTATACACTGTTTCTGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-570s21c1
Sequence:CCGGTTGGATTAACTCGGGAGATTCCTCGAGGAATCTCCCGAGTTAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-1035s21c1
Sequence:CCGGGCACTAAACATGGTGATATTCCTCGAGGAATATCACCATGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-469s21c1
Sequence:CCGGCAGTGAATCAGGCACAATAATCTCGAGATTATTGTGCCTGATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001765
CD1C MISSION shRNA Lentiviral Transduction Particles
CD1c molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-462s1c1
Sequence:CCGGCGGATTAGATTTACTGAGTTTCTCGAGAAACTCAGTAAATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-300s1c1
Sequence:CCGGCCTAGAGTTGTTATTTCGTTTCTCGAGAAACGAAATAACAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-1026s1c1
Sequence:CCGGGCACTGCTCATATCAGGACATCTCGAGATGTCCTGATATGAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-358s1c1
Sequence:CCGGGCAAGTCAAGATTACTCGAAACTCGAGTTTCGAGTAATCTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001765.1-566s1c1
Sequence:CCGGGCGTCACAGAAACAGTGTATACTCGAGTATACACTGTTTCTGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-570s21c1
Sequence:CCGGTTGGATTAACTCGGGAGATTCCTCGAGGAATCTCCCGAGTTAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-1035s21c1
Sequence:CCGGGCACTAAACATGGTGATATTCCTCGAGGAATATCACCATGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001765.2-469s21c1
Sequence:CCGGCAGTGAATCAGGCACAATAATCTCGAGATTATTGTGCCTGATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks