EMAIL THIS PAGE TO A FRIEND

CD1D

CD1d molecule

150 Gene Product Result for
Synonyms: CD1A R3
UniProtKB ID: P15813, D3DVD5, Q5W0J3, Q9UMM3, Q9Y5M4
Gene ID:
Human(912) Summary: This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. [provided by RefSeq, Jul 2008]
sheep(100144424) CD1d molecule
Horse(100054770) CD1d molecule
cow(516046) CD1D antigen, d polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001766 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146871 MISSION® esiRNA esiRNA human CD1D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001766 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332501 predicted 894
2 SASI_Hs02_00332502 predicted 1076
3 SASI_Hs01_00081581 predicted 1465
4 SASI_Hs02_00332503 predicted 791
5 SASI_Hs01_00081582 predicted 968
6 SASI_Hs01_00081583 predicted 1183
7 SASI_Hs02_00332504 predicted 1022
8 SASI_Hs01_00081586 predicted 820
9 SASI_Hs02_00332505 predicted 755
10 SASI_Hs01_00081587 predicted 1384
11 SASI_Hs01_00081579 predicted 786
12 SASI_Hs01_00081580 predicted 751
13 SASI_Hs01_00081584 predicted 1457
14 SASI_Hs01_00081585 predicted 981
15 SASI_Hs01_00081588 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001766
VALIDATED
CD1D MISSION shRNA Bacterial Glycerol Stock
CD1d molecule
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-765s21c1
Sequence:CCGGGGGTTTATCGAAGCAGCTTCACTCGAGTGAAGCTGCTTCGATAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-595s21c1
Sequence:CCGGGATCTCGTCCTTCGCCAATAGCTCGAGCTATTGGCGAAGGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1888s21c1
Sequence:CCGGGCTGCTTGTTGTCAAGTATAACTCGAGTTATACTTGACAACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-812s21c1
Sequence:CCGGATGCTACGCTTATCCTATCCCCTCGAGGGGATAGGATAAGCGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-741s21c1
Sequence:CCGGGGGAGACGCTGCAGCATATATCTCGAGATATATGCTGCAGCGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1720s21c1
Sequence:CCGGTACAAGTTTATAAGCCCAAATCTCGAGATTTGGGCTTATAAACTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1395s21c1
Sequence:CCGGACACCTCCATGGGCTTGATTGCTCGAGCAATCAAGCCCATGGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1191s21c1
Sequence:CCGGCAAAGCCTGTATGGGTGAAGTCTCGAGACTTCACCCATACAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1022s21c1
Sequence:CCGGACAGTGCAGTGGCTCCTTAATCTCGAGATTAAGGAGCCACTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1456s21c1
Sequence:CCGGGGGCTTTACCTCCCGGTTTAACTCGAGTTAAACCGGGAGGTAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-868s21c1
Sequence:CCGGCCCTGGGAACGCCTCAAATAACTCGAGTTATTTGAGGCGTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001766.2-814s1c1
Sequence:CCGGGCTACGCTTATCCTATCCCTTCTCGAGAAGGGATAGGATAAGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1443s1c1
Sequence:CCGGTCCTCCTCATTGTGGGCTTTACTCGAGTAAAGCCCACAATGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-878s1c1
Sequence:CCGGGCCTCAAATAACTTCTTCCATCTCGAGATGGAAGAAGTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1467s1c1
Sequence:CCGGCCCGGTTTAAGAGGCAAACTTCTCGAGAAGTTTGCCTCTTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-968s1c1
Sequence:CCGGCTTTGGGTAAACTTGGCCATTCTCGAGAATGGCCAAGTTTACCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001766
VALIDATED
CD1D MISSION shRNA shRNA Plasmid DNA
CD1d molecule
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-765s21c1
Sequence:CCGGGGGTTTATCGAAGCAGCTTCACTCGAGTGAAGCTGCTTCGATAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-595s21c1
Sequence:CCGGGATCTCGTCCTTCGCCAATAGCTCGAGCTATTGGCGAAGGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1888s21c1
Sequence:CCGGGCTGCTTGTTGTCAAGTATAACTCGAGTTATACTTGACAACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-812s21c1
Sequence:CCGGATGCTACGCTTATCCTATCCCCTCGAGGGGATAGGATAAGCGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-741s21c1
Sequence:CCGGGGGAGACGCTGCAGCATATATCTCGAGATATATGCTGCAGCGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1720s21c1
Sequence:CCGGTACAAGTTTATAAGCCCAAATCTCGAGATTTGGGCTTATAAACTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1395s21c1
Sequence:CCGGACACCTCCATGGGCTTGATTGCTCGAGCAATCAAGCCCATGGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1191s21c1
Sequence:CCGGCAAAGCCTGTATGGGTGAAGTCTCGAGACTTCACCCATACAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1022s21c1
Sequence:CCGGACAGTGCAGTGGCTCCTTAATCTCGAGATTAAGGAGCCACTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1456s21c1
Sequence:CCGGGGGCTTTACCTCCCGGTTTAACTCGAGTTAAACCGGGAGGTAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-868s21c1
Sequence:CCGGCCCTGGGAACGCCTCAAATAACTCGAGTTATTTGAGGCGTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001766.2-814s1c1
Sequence:CCGGGCTACGCTTATCCTATCCCTTCTCGAGAAGGGATAGGATAAGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1443s1c1
Sequence:CCGGTCCTCCTCATTGTGGGCTTTACTCGAGTAAAGCCCACAATGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-878s1c1
Sequence:CCGGGCCTCAAATAACTTCTTCCATCTCGAGATGGAAGAAGTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1467s1c1
Sequence:CCGGCCCGGTTTAAGAGGCAAACTTCTCGAGAAGTTTGCCTCTTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-968s1c1
Sequence:CCGGCTTTGGGTAAACTTGGCCATTCTCGAGAATGGCCAAGTTTACCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001766
VALIDATED
CD1D MISSION shRNA Lentiviral Transduction Particles
CD1d molecule
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-765s21c1
Sequence:CCGGGGGTTTATCGAAGCAGCTTCACTCGAGTGAAGCTGCTTCGATAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-595s21c1
Sequence:CCGGGATCTCGTCCTTCGCCAATAGCTCGAGCTATTGGCGAAGGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1888s21c1
Sequence:CCGGGCTGCTTGTTGTCAAGTATAACTCGAGTTATACTTGACAACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-812s21c1
Sequence:CCGGATGCTACGCTTATCCTATCCCCTCGAGGGGATAGGATAAGCGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-741s21c1
Sequence:CCGGGGGAGACGCTGCAGCATATATCTCGAGATATATGCTGCAGCGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001766.3-1720s21c1
Sequence:CCGGTACAAGTTTATAAGCCCAAATCTCGAGATTTGGGCTTATAAACTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1395s21c1
Sequence:CCGGACACCTCCATGGGCTTGATTGCTCGAGCAATCAAGCCCATGGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1191s21c1
Sequence:CCGGCAAAGCCTGTATGGGTGAAGTCTCGAGACTTCACCCATACAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1022s21c1
Sequence:CCGGACAGTGCAGTGGCTCCTTAATCTCGAGATTAAGGAGCCACTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-1456s21c1
Sequence:CCGGGGGCTTTACCTCCCGGTTTAACTCGAGTTAAACCGGGAGGTAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001766.3-868s21c1
Sequence:CCGGCCCTGGGAACGCCTCAAATAACTCGAGTTATTTGAGGCGTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001766.2-814s1c1
Sequence:CCGGGCTACGCTTATCCTATCCCTTCTCGAGAAGGGATAGGATAAGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1443s1c1
Sequence:CCGGTCCTCCTCATTGTGGGCTTTACTCGAGTAAAGCCCACAATGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-878s1c1
Sequence:CCGGGCCTCAAATAACTTCTTCCATCTCGAGATGGAAGAAGTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-1467s1c1
Sequence:CCGGCCCGGTTTAAGAGGCAAACTTCTCGAGAAGTTTGCCTCTTAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001766.2-968s1c1
Sequence:CCGGCTTTGGGTAAACTTGGCCATTCTCGAGAATGGCCAAGTTTACCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks