EMAIL THIS PAGE TO A FRIEND

CD1E

CD1e molecule

160 Gene Product Result for
Synonyms: CD1A R2
Species: Human CD1E(913), domestic guinea pig Cd1e(100379271), Domestic Rabbit CD1E(100008782), dog CD1E(488610), cow CD1E(510832), domestic cat CD1E(101098516)
Gene ID:
Human(913) Summary: This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes within Golgi compartments, endosomes, and lysosomes, and is cleaved into a stable soluble form. The soluble form is required for the intracellular processing of some glycolipids into a form that can be presented by other CD1 family members. Many alternatively spliced transcript variants encoding different isoforms have been described. Additional transcript variants have been found; however, their biological validity has not been determined. [provided by RefSeq, Jun 2010]
dog(488610) CD1e molecule
cow(510832) CD1e molecule
domestic cat(101098516) CD1e molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306572 ANTI-CD1E (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
HPA057769 Anti-CD1E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030893 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044831 MISSION® esiRNA esiRNA human CD1E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042583 Rosetta Predictions human pricing
NM_001042584 Rosetta Predictions human pricing
NM_001042585 Rosetta Predictions human pricing
NM_001042586 Rosetta Predictions human pricing
NM_001042587 Rosetta Predictions human pricing
NM_030893 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310648 predicted 757
2 SASI_Hs02_00310649 predicted 1200
3 SASI_Hs02_00310650 predicted 1163
4 SASI_Hs02_00310651 predicted 691
5 SASI_Hs02_00310652 predicted 1189
6 SASI_Hs02_00310653 predicted 1158
7 SASI_Hs02_00310654 predicted 1178
8 SASI_Hs02_00310655 predicted 837
9 SASI_Hs02_00310656 predicted 659
10 SASI_Hs02_00310657 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310658 predicted 1040
2 SASI_Hs02_00310659 predicted 755
3 SASI_Hs02_00310660 predicted 1095
4 SASI_Hs02_00310661 predicted 1063
5 SASI_Hs02_00310662 predicted 689
6 SASI_Hs02_00310663 predicted 1090
7 SASI_Hs02_00310664 predicted 1056
8 SASI_Hs02_00310665 predicted 775
9 SASI_Hs02_00310666 predicted 1076
10 SASI_Hs02_00310667 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310668 predicted 755
2 SASI_Hs02_00310669 predicted 1040
3 SASI_Hs02_00310670 predicted 1006
4 SASI_Hs02_00310671 predicted 685
5 SASI_Hs02_00310672 predicted 1030
6 SASI_Hs02_00310673 predicted 979
7 SASI_Hs02_00310674 predicted 993
8 SASI_Hs02_00310675 predicted 1016
9 SASI_Hs02_00310676 predicted 840
10 SASI_Hs02_00310677 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310678 predicted 635
2 SASI_Hs02_00310679 predicted 598
3 SASI_Hs02_00310680 predicted 1104
4 SASI_Hs02_00310681 predicted 626
5 SASI_Hs02_00310682 predicted 1061
6 SASI_Hs02_00310683 predicted 1077
7 SASI_Hs02_00310684 predicted 595
8 SASI_Hs02_00310685 predicted 608
9 SASI_Hs02_00310686 predicted 885
10 SASI_Hs02_00310687 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310688 predicted 473
2 SASI_Hs02_00310689 predicted 529
3 SASI_Hs02_00310690 predicted 492
4 SASI_Hs02_00310691 predicted 1030
5 SASI_Hs02_00310692 predicted 521
6 SASI_Hs02_00310693 predicted 996
7 SASI_Hs02_00310694 predicted 1006
8 SASI_Hs02_00310695 predicted 493
9 SASI_Hs02_00310696 predicted 507
10 SASI_Hs02_00310697 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193862 predicted 760
2 SASI_Hs02_00358421 predicted 1203
3 SASI_Hs02_00358422 predicted 1171
4 SASI_Hs01_00193865 predicted 684
5 SASI_Hs02_00358423 predicted 1194
6 SASI_Hs02_00358424 predicted 1163
7 SASI_Hs02_00358425 predicted 1178
8 SASI_Hs02_00358426 predicted 839
9 SASI_Hs02_00358427 predicted 658
10 SASI_Hs02_00358428 predicted 632
11 SASI_Hs01_00193863 predicted 479
12 SASI_Hs01_00193864 predicted 459
13 SASI_Hs01_00193866 predicted 575
14 SASI_Hs01_00193867 predicted 253
15 SASI_Hs01_00193868 predicted 290
16 SASI_Hs01_00193869 predicted 261
17 SASI_Hs01_00193870 predicted 509
18 SASI_Hs01_00193871 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030893
CD1E MISSION shRNA Bacterial Glycerol Stock
CD1e molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-261s1c1
Sequence:CCGGCCAGTTATACTTCCATAGTTTCTCGAGAAACTATGGAAGTATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-90s1c1
Sequence:CCGGCCAAACTTCCTCCTTTGCCAACTCGAGTTGGCAAAGGAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-328s1c1
Sequence:CCGGCCCTTCGAGATCCAGATATTACTCGAGTAATATCTGGATCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-491s1c1
Sequence:CCGGGCTACCTAGATATTAAGGAAACTCGAGTTTCCTTAATATCTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-574s1c1
Sequence:CCGGGAGTCAGAACTGAAACGGAAACTCGAGTTTCCGTTTCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1184s21c1
Sequence:CCGGGATAGTTACCCTGGTCATATTCTCGAGAATATGACCAGGGTAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1208s21c1
Sequence:CCGGTGTAGTTGACTCACGGTTAAACTCGAGTTTAACCGTGAGTCAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030893.2-1766s21c1
Sequence:CCGGGTTGCTTGAAAGTAGGATTTACTCGAGTAAATCCTACTTTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-564s21c1
Sequence:CCGGCAAGCTTCTGCTGGTCAATTTCTCGAGAAATTGACCAGCAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030893
CD1E MISSION shRNA shRNA Plasmid DNA
CD1e molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-261s1c1
Sequence:CCGGCCAGTTATACTTCCATAGTTTCTCGAGAAACTATGGAAGTATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-90s1c1
Sequence:CCGGCCAAACTTCCTCCTTTGCCAACTCGAGTTGGCAAAGGAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-328s1c1
Sequence:CCGGCCCTTCGAGATCCAGATATTACTCGAGTAATATCTGGATCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-491s1c1
Sequence:CCGGGCTACCTAGATATTAAGGAAACTCGAGTTTCCTTAATATCTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-574s1c1
Sequence:CCGGGAGTCAGAACTGAAACGGAAACTCGAGTTTCCGTTTCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1184s21c1
Sequence:CCGGGATAGTTACCCTGGTCATATTCTCGAGAATATGACCAGGGTAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1208s21c1
Sequence:CCGGTGTAGTTGACTCACGGTTAAACTCGAGTTTAACCGTGAGTCAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030893.2-1766s21c1
Sequence:CCGGGTTGCTTGAAAGTAGGATTTACTCGAGTAAATCCTACTTTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-564s21c1
Sequence:CCGGCAAGCTTCTGCTGGTCAATTTCTCGAGAAATTGACCAGCAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030893
CD1E MISSION shRNA Lentiviral Transduction Particles
CD1e molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-261s1c1
Sequence:CCGGCCAGTTATACTTCCATAGTTTCTCGAGAAACTATGGAAGTATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-90s1c1
Sequence:CCGGCCAAACTTCCTCCTTTGCCAACTCGAGTTGGCAAAGGAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-328s1c1
Sequence:CCGGCCCTTCGAGATCCAGATATTACTCGAGTAATATCTGGATCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-491s1c1
Sequence:CCGGGCTACCTAGATATTAAGGAAACTCGAGTTTCCTTAATATCTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030893.1-574s1c1
Sequence:CCGGGAGTCAGAACTGAAACGGAAACTCGAGTTTCCGTTTCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1184s21c1
Sequence:CCGGGATAGTTACCCTGGTCATATTCTCGAGAATATGACCAGGGTAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-1208s21c1
Sequence:CCGGTGTAGTTGACTCACGGTTAAACTCGAGTTTAACCGTGAGTCAACTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030893.2-1766s21c1
Sequence:CCGGGTTGCTTGAAAGTAGGATTTACTCGAGTAAATCCTACTTTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030893.2-564s21c1
Sequence:CCGGCAAGCTTCTGCTGGTCAATTTCTCGAGAAATTGACCAGCAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks