EMAIL THIS PAGE TO A FRIEND

CD200

CD200 molecule

148 Gene Product Result for
Synonyms: MOX1 MOX2 MRC OX-2
Gene ID:
Human(4345) Summary: The protein encoded by this gene is a type-1 membrane glycoprotein, which contains two immunoglobulin domains, and thus belongs to the immunoglobulin superfamily. Studies of the related genes in mouse and rat suggest that this gene may regulate myeloid cell activity and delivers an inhibitory signal for the macrophage lineage in diverse tissues. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17470) CD200 antigen
Rat(24560) Cd200 molecule
sheep(101120715) CD200 molecule
chicken(418425) CD200 molecule
cow(534910) CD200 molecule
domestic cat(101096094) CD200 molecule
dog(607499) CD200 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004196 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004196 Rosetta Predictions human pricing
NM_005944 Rosetta Predictions human pricing
NM_031518 Rosetta Predictions rat pricing
NM_010818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122110 predicted 961
2 SASI_Hs01_00122111 predicted 903
3 SASI_Hs01_00122112 predicted 939
4 SASI_Hs01_00122113 predicted 876
5 SASI_Hs01_00122114 predicted 952
6 SASI_Hs01_00122115 predicted 883
7 SASI_Hs01_00122116 predicted 637
8 SASI_Hs01_00122117 predicted 622
9 SASI_Hs01_00122118 predicted 652
10 SASI_Hs01_00122119 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070124 predicted 826
2 SASI_Hs02_00340607 predicted 1138
3 SASI_Hs01_00070125 predicted 864
4 SASI_Hs02_00340608 predicted 868
5 SASI_Hs02_00340609 predicted 1136
6 SASI_Hs01_00070127 predicted 874
7 SASI_Hs01_00070129 predicted 567
8 SASI_Hs01_00070132 predicted 731
9 SASI_Hs02_00340610 predicted 408
10 SASI_Hs02_00340611 predicted 551
11 SASI_Hs01_00070123 predicted 899
12 SASI_Hs01_00070126 predicted 803
13 SASI_Hs01_00070128 predicted 817
14 SASI_Hs01_00070130 predicted 562
15 SASI_Hs01_00070131 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078740 predicted 746
2 SASI_Rn01_00078741 predicted 768
3 SASI_Rn01_00078742 predicted 849
4 SASI_Rn01_00078743 predicted 898
5 SASI_Rn01_00078744 predicted 653
6 SASI_Rn01_00078745 predicted 944
7 SASI_Rn01_00078746 predicted 580
8 SASI_Rn01_00078747 predicted 447
9 SASI_Rn01_00078748 predicted 594
10 SASI_Rn02_00264647 predicted 793
11 SASI_Rn01_00078739 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319420 predicted 357
2 SASI_Mm01_00092266 predicted 1022
3 SASI_Mm01_00092262 predicted 444
4 SASI_Mm01_00092263 predicted 602
5 SASI_Mm01_00092264 predicted 807
6 SASI_Mm01_00092267 predicted 958
7 SASI_Mm01_00092268 predicted 611
8 SASI_Mm02_00319421 predicted 596
9 SASI_Mm02_00319422 predicted 746
10 SASI_Mm01_00092269 predicted 908
11 SASI_Mm01_00092265 predicted 913
12 SASI_Mm01_00092270 predicted 896
13 SASI_Mm01_00092271 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010818
VALIDATED
CD200 MISSION shRNA Bacterial Glycerol Stock
CD200 molecule
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-286s1c1
Sequence:CCGGCCTGCCTACAAAGACAGGATACTCGAGTATCCTGTCTTTGTAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-573s1c1
Sequence:CCGGCGAGAGTCACTTCCATTCAAACTCGAGTTTGAATGGAAGTGACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-703s1c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-163s1c1
Sequence:CCGGGCATCCTTACGATGTTCTCTACTCGAGTAGAGAACATCGTAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-450s1c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-958s21c1
Sequence:CCGGTACTGGAAACGTCACCGAAATCTCGAGATTTCGGTGACGTTTCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-440s21c1
Sequence:CCGGTAATCCAGCCTGCCTACAAAGCTCGAGCTTTGTAGGCAGGCTGGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-612s21c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-865s21c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010818
VALIDATED
CD200 MISSION shRNA shRNA Plasmid DNA
CD200 molecule
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-286s1c1
Sequence:CCGGCCTGCCTACAAAGACAGGATACTCGAGTATCCTGTCTTTGTAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-573s1c1
Sequence:CCGGCGAGAGTCACTTCCATTCAAACTCGAGTTTGAATGGAAGTGACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-703s1c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-163s1c1
Sequence:CCGGGCATCCTTACGATGTTCTCTACTCGAGTAGAGAACATCGTAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-450s1c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-958s21c1
Sequence:CCGGTACTGGAAACGTCACCGAAATCTCGAGATTTCGGTGACGTTTCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-440s21c1
Sequence:CCGGTAATCCAGCCTGCCTACAAAGCTCGAGCTTTGTAGGCAGGCTGGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-612s21c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-865s21c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010818
VALIDATED
CD200 MISSION shRNA Lentiviral Transduction Particles
CD200 molecule
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-286s1c1
Sequence:CCGGCCTGCCTACAAAGACAGGATACTCGAGTATCCTGTCTTTGTAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-573s1c1
Sequence:CCGGCGAGAGTCACTTCCATTCAAACTCGAGTTTGAATGGAAGTGACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-703s1c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010818.2-163s1c1
Sequence:CCGGGCATCCTTACGATGTTCTCTACTCGAGTAGAGAACATCGTAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010818.2-450s1c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-958s21c1
Sequence:CCGGTACTGGAAACGTCACCGAAATCTCGAGATTTCGGTGACGTTTCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-440s21c1
Sequence:CCGGTAATCCAGCCTGCCTACAAAGCTCGAGCTTTGTAGGCAGGCTGGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-612s21c1
Sequence:CCGGGCCCATAGTACACCTTCACTACTCGAGTAGTGAAGGTGTACTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010818.3-865s21c1
Sequence:CCGGCAGAGTCTGGACAAAGGATTTCTCGAGAAATCCTTTGTCCAGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004196
CD200 MISSION shRNA Bacterial Glycerol Stock
CD200 molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004196.1-1581s1c1
Sequence:CCGGCCTTGCTAGAATCCTTGGTTTCTCGAGAAACCAAGGATTCTAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-587s1c1
Sequence:CCGGGCCCATAGTATCCCTTCACTACTCGAGTAGTGAAGGGATACTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-755s1c1
Sequence:CCGGCCTCCATATCAAAGACCCTAACTCGAGTTAGGGTCTTTGATATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-423s1c1
Sequence:CCGGCCTGCCTATAAGGACAAGATACTCGAGTATCTTGTCCTTATAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1353s21c1
Sequence:CCGGGGACCTCTGTTAGTCACTTTACTCGAGTAAAGTGACTAACAGAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1235s21c1
Sequence:CCGGGTCTGTTGTAGGACTTGATTTCTCGAGAAATCAAGTCCTACAACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1289s21c1
Sequence:CCGGGCACTGGACTTAGTTAGTATCCTCGAGGATACTAACTAAGTCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004196
CD200 MISSION shRNA shRNA Plasmid DNA
CD200 molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004196.1-1581s1c1
Sequence:CCGGCCTTGCTAGAATCCTTGGTTTCTCGAGAAACCAAGGATTCTAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-587s1c1
Sequence:CCGGGCCCATAGTATCCCTTCACTACTCGAGTAGTGAAGGGATACTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-755s1c1
Sequence:CCGGCCTCCATATCAAAGACCCTAACTCGAGTTAGGGTCTTTGATATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-423s1c1
Sequence:CCGGCCTGCCTATAAGGACAAGATACTCGAGTATCTTGTCCTTATAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1353s21c1
Sequence:CCGGGGACCTCTGTTAGTCACTTTACTCGAGTAAAGTGACTAACAGAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1235s21c1
Sequence:CCGGGTCTGTTGTAGGACTTGATTTCTCGAGAAATCAAGTCCTACAACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1289s21c1
Sequence:CCGGGCACTGGACTTAGTTAGTATCCTCGAGGATACTAACTAAGTCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004196
CD200 MISSION shRNA Lentiviral Transduction Particles
CD200 molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004196.1-1581s1c1
Sequence:CCGGCCTTGCTAGAATCCTTGGTTTCTCGAGAAACCAAGGATTCTAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-587s1c1
Sequence:CCGGGCCCATAGTATCCCTTCACTACTCGAGTAGTGAAGGGATACTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-755s1c1
Sequence:CCGGCCTCCATATCAAAGACCCTAACTCGAGTTAGGGTCTTTGATATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004196.1-423s1c1
Sequence:CCGGCCTGCCTATAAGGACAAGATACTCGAGTATCTTGTCCTTATAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1353s21c1
Sequence:CCGGGGACCTCTGTTAGTCACTTTACTCGAGTAAAGTGACTAACAGAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1235s21c1
Sequence:CCGGGTCTGTTGTAGGACTTGATTTCTCGAGAAATCAAGTCCTACAACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004196.2-1289s21c1
Sequence:CCGGGCACTGGACTTAGTTAGTATCCTCGAGGATACTAACTAAGTCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)