EMAIL THIS PAGE TO A FRIEND

CD200R1

CD200 receptor 1

171 Gene Product Result for
Synonyms: CD200R HCRTR2 MOX2R OX2R
Gene ID:
Human(131450) Summary: This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(57781) CD200 receptor 1
Rat(64357) CD200 receptor 1
chicken(768673) CD200 receptor 1
dog(487977) CD200 receptor 1
cow(100335828) CD200 receptor 1
naked mole-rat(101724227) CD200 receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138806 Rosetta Predictions human pricing
NM_138939 Rosetta Predictions human pricing
NM_138940 Rosetta Predictions human pricing
NM_170780 Rosetta Predictions human pricing
NM_023953 Rosetta Predictions rat pricing
NM_021325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161969 predicted 1072
2 SASI_Hs01_00161970 predicted 922
3 SASI_Hs01_00161971 predicted 1089
4 SASI_Hs01_00161972 predicted 1195
5 SASI_Hs01_00161973 predicted 1313
6 SASI_Hs01_00161974 predicted 845
7 SASI_Hs01_00161975 predicted 1232
8 SASI_Hs01_00161976 predicted 1315
9 SASI_Hs01_00161977 predicted 982
10 SASI_Hs01_00161978 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039311 predicted 664
2 SASI_Hs01_00039312 predicted 760
3 SASI_Hs01_00039313 predicted 753
4 SASI_Hs01_00039314 predicted 771
5 SASI_Hs01_00039315 predicted 784
6 SASI_Hs01_00039316 predicted 748
7 SASI_Hs01_00039317 predicted 744
8 SASI_Hs01_00039318 predicted 789
9 SASI_Hs01_00039319 predicted 779
10 SASI_Hs01_00039320 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121456 predicted 599
2 SASI_Hs01_00121457 predicted 690
3 SASI_Hs01_00121458 predicted 685
4 SASI_Hs01_00121459 predicted 705
5 SASI_Hs01_00121460 predicted 716
6 SASI_Hs01_00121461 predicted 678
7 SASI_Hs01_00121462 predicted 672
8 SASI_Hs01_00121463 predicted 722
9 SASI_Hs01_00121464 predicted 708
10 SASI_Hs01_00121465 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207271 predicted 1007
2 SASI_Hs01_00207272 predicted 857
3 SASI_Hs01_00207273 predicted 1022
4 SASI_Hs01_00207274 predicted 1128
5 SASI_Hs01_00207275 predicted 1251
6 SASI_Hs01_00207276 predicted 775
7 SASI_Hs01_00207277 predicted 1162
8 SASI_Hs01_00207278 predicted 1241
9 SASI_Hs01_00207279 predicted 916
10 SASI_Hs01_00207280 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064435 predicted 709
2 SASI_Rn02_00263752 predicted 724
3 SASI_Rn02_00263753 predicted 210
4 SASI_Rn02_00263754 predicted 213
5 SASI_Rn01_00064440 predicted 695
6 SASI_Rn02_00263755 predicted 617
7 SASI_Rn02_00263756 predicted 749
8 SASI_Rn02_00263757 predicted 510
9 SASI_Rn02_00263758 predicted 699
10 SASI_Rn02_00263759 predicted 496
11 SASI_Rn01_00064432 predicted 229
12 SASI_Rn01_00064433 predicted 369
13 SASI_Rn01_00064434 predicted 663
14 SASI_Rn01_00064436 predicted 275
15 SASI_Rn01_00064437 predicted 377
16 SASI_Rn01_00064438 predicted 625
17 SASI_Rn01_00064439 predicted 319
18 SASI_Rn01_00064441 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145746 predicted 1277
2 SASI_Mm01_00145748 predicted 981
3 SASI_Mm01_00145749 predicted 966
4 SASI_Mm01_00145750 predicted 315
5 SASI_Mm01_00145751 predicted 1114
6 SASI_Mm02_00325888 predicted 1091
7 SASI_Mm01_00145752 predicted 930
8 SASI_Mm02_00325889 predicted 1148
9 SASI_Mm02_00325890 predicted 513
10 SASI_Mm02_00325891 predicted 1193
11 SASI_Mm01_00145747 predicted 430
12 SASI_Mm01_00145753 predicted 605
13 SASI_Mm01_00145754 predicted 859
14 SASI_Mm01_00145755 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021325
CD200R1 MISSION shRNA Bacterial Glycerol Stock
CD200 receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021325.3-1022s21c1
Sequence:CCGGTGATCATCATAGGATGCATTTCTCGAGAAATGCATCCTATGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1614s21c1
Sequence:CCGGTATGGTATGTGTGTCCAATTACTCGAGTAATTGGACACACATACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1676s21c1
Sequence:CCGGTTCAGGACATCTCCTTGTAAACTCGAGTTTACAAGGAGATGTCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021325.2-1429s1c1
Sequence:CCGGGCACATGGTTATGGTGAAATACTCGAGTATTTCACCATAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1141s1c1
Sequence:CCGGGAGGCATTTCCAGTATCACAACTCGAGTTGTGATACTGGAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-930s1c1
Sequence:CCGGCCAATCATTACGACCATATATCTCGAGATATATGGTCGTAATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1115s1c1
Sequence:CCGGCACTCTATGATACTGTGACTACTCGAGTAGTCACAGTATCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-952s1c1
Sequence:CCGGCCATACATCATACCATCAATTCTCGAGAATTGATGGTATGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021325
CD200R1 MISSION shRNA shRNA Plasmid DNA
CD200 receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021325.3-1022s21c1
Sequence:CCGGTGATCATCATAGGATGCATTTCTCGAGAAATGCATCCTATGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1614s21c1
Sequence:CCGGTATGGTATGTGTGTCCAATTACTCGAGTAATTGGACACACATACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1676s21c1
Sequence:CCGGTTCAGGACATCTCCTTGTAAACTCGAGTTTACAAGGAGATGTCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021325.2-1429s1c1
Sequence:CCGGGCACATGGTTATGGTGAAATACTCGAGTATTTCACCATAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1141s1c1
Sequence:CCGGGAGGCATTTCCAGTATCACAACTCGAGTTGTGATACTGGAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-930s1c1
Sequence:CCGGCCAATCATTACGACCATATATCTCGAGATATATGGTCGTAATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1115s1c1
Sequence:CCGGCACTCTATGATACTGTGACTACTCGAGTAGTCACAGTATCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-952s1c1
Sequence:CCGGCCATACATCATACCATCAATTCTCGAGAATTGATGGTATGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021325
CD200R1 MISSION shRNA Lentiviral Transduction Particles
CD200 receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021325.3-1022s21c1
Sequence:CCGGTGATCATCATAGGATGCATTTCTCGAGAAATGCATCCTATGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1614s21c1
Sequence:CCGGTATGGTATGTGTGTCCAATTACTCGAGTAATTGGACACACATACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021325.3-1676s21c1
Sequence:CCGGTTCAGGACATCTCCTTGTAAACTCGAGTTTACAAGGAGATGTCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021325.2-1429s1c1
Sequence:CCGGGCACATGGTTATGGTGAAATACTCGAGTATTTCACCATAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1141s1c1
Sequence:CCGGGAGGCATTTCCAGTATCACAACTCGAGTTGTGATACTGGAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-930s1c1
Sequence:CCGGCCAATCATTACGACCATATATCTCGAGATATATGGTCGTAATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-1115s1c1
Sequence:CCGGCACTCTATGATACTGTGACTACTCGAGTAGTCACAGTATCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021325.2-952s1c1
Sequence:CCGGCCATACATCATACCATCAATTCTCGAGAATTGATGGTATGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138806
CD200R1 MISSION shRNA Bacterial Glycerol Stock
CD200 receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-670s21c1
Sequence:CCGGCCATCACTCATGACGGGTATTCTCGAGAATACCCGTCATGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138806.3-1611s21c1
Sequence:CCGGGTGTATCCTTTCAGAATATTTCTCGAGAAATATTCTGAAAGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-315s21c1
Sequence:CCGGGCTCAACCAAACAACTCATTACTCGAGTAATGAGTTGTTTGGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138806.3-1688s1c1
Sequence:CCGGCCTTACATATACATGCACATACTCGAGTATGTGCATGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-561s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-376s1c1
Sequence:CCGGGCAGTTTATGTATGGATGAAACTCGAGTTTCATCCATACATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-1188s1c1
Sequence:CCGGGAGAAGAACAATCCTCTCTATCTCGAGATAGAGAGGATTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-338s1c1
Sequence:CCGGGCTGCAAACTAGCAAGGAGAACTCGAGTTCTCCTTGCTAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138806
CD200R1 MISSION shRNA shRNA Plasmid DNA
CD200 receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-670s21c1
Sequence:CCGGCCATCACTCATGACGGGTATTCTCGAGAATACCCGTCATGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138806.3-1611s21c1
Sequence:CCGGGTGTATCCTTTCAGAATATTTCTCGAGAAATATTCTGAAAGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-315s21c1
Sequence:CCGGGCTCAACCAAACAACTCATTACTCGAGTAATGAGTTGTTTGGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138806.3-1688s1c1
Sequence:CCGGCCTTACATATACATGCACATACTCGAGTATGTGCATGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-561s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-376s1c1
Sequence:CCGGGCAGTTTATGTATGGATGAAACTCGAGTTTCATCCATACATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-1188s1c1
Sequence:CCGGGAGAAGAACAATCCTCTCTATCTCGAGATAGAGAGGATTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-338s1c1
Sequence:CCGGGCTGCAAACTAGCAAGGAGAACTCGAGTTCTCCTTGCTAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138806
CD200R1 MISSION shRNA Lentiviral Transduction Particles
CD200 receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-670s21c1
Sequence:CCGGCCATCACTCATGACGGGTATTCTCGAGAATACCCGTCATGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138806.3-1611s21c1
Sequence:CCGGGTGTATCCTTTCAGAATATTTCTCGAGAAATATTCTGAAAGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138806.3-315s21c1
Sequence:CCGGGCTCAACCAAACAACTCATTACTCGAGTAATGAGTTGTTTGGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138806.3-1688s1c1
Sequence:CCGGCCTTACATATACATGCACATACTCGAGTATGTGCATGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-561s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-376s1c1
Sequence:CCGGGCAGTTTATGTATGGATGAAACTCGAGTTTCATCCATACATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-1188s1c1
Sequence:CCGGGAGAAGAACAATCCTCTCTATCTCGAGATAGAGAGGATTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138806.3-338s1c1
Sequence:CCGGGCTGCAAACTAGCAAGGAGAACTCGAGTTCTCCTTGCTAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks