EMAIL THIS PAGE TO A FRIEND

CD200R1L

CD200 receptor 1-like

54 Gene Product Result for
Synonyms: CD200R2 CD200RLa
UniProtKB ID: Q6Q8B3, Q6WHB7
Gene ID:
Rat(501779) CD200 receptor 1-like
naked mole-rat(101698660) CD200 receptor 1-like
chicken(418367) CD200 receptor 1-like
dog(487976) cell surface glycoprotein CD200 receptor 1-like
cow(516008) CD200 receptor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305898 ANTI-CD200R1L(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008784 Rosetta Predictions human pricing
XM_001067018 Rosetta Predictions rat pricing
XM_577181 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090796 predicted 870
2 SASI_Hs01_00090797 predicted 747
3 SASI_Hs01_00090798 predicted 349
4 SASI_Hs02_00305581 predicted 284
5 SASI_Hs01_00090799 predicted 664
6 SASI_Hs01_00090800 predicted 755
7 SASI_Hs01_00090801 predicted 307
8 SASI_Hs01_00090802 predicted 1012
9 SASI_Hs01_00090803 predicted 882
10 SASI_Hs01_00090804 predicted 300
11 SASI_Hs01_00090805 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319558 predicted 478
2 SASI_Rn02_00319559 predicted 446
3 SASI_Rn02_00319560 predicted 448
4 SASI_Rn02_00319561 predicted 489
5 SASI_Rn02_00319562 predicted 454
6 SASI_Rn02_00319563 predicted 455
7 SASI_Rn02_00319564 predicted 44
8 SASI_Rn02_00319565 predicted 655
9 SASI_Rn02_00319566 predicted 40
10 SASI_Rn02_00319567 predicted 102
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406285 predicted 479
2 SASI_Rn02_00406286 predicted 442
3 SASI_Rn02_00406287 predicted 448
4 SASI_Rn02_00406288 predicted 488
5 SASI_Rn02_00406289 predicted 452
6 SASI_Rn02_00406290 predicted 453
7 SASI_Rn02_00406291 predicted 49
8 SASI_Rn02_00406292 predicted 652
9 SASI_Rn02_00406293 predicted 43
10 SASI_Rn02_00406294 predicted 98
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008784
CD200R1L MISSION shRNA Bacterial Glycerol Stock
CD200 receptor 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-873s1c1
Sequence:CCGGGCAACAAGAGTCTGTCCGTAACTCGAGTTACGGACAGACTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-877s1c1
Sequence:CCGGCAAGAGTCTGTCCGTAAAGTTCTCGAGAACTTTACGGACAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1044s1c1
Sequence:CCGGGAAGAAGGAAGGGTCTTCTTTCTCGAGAAAGAAGACCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1132s1c1
Sequence:CCGGGCCATGGATGATGTTAAGGATCTCGAGATCCTTAACATCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-874s1c1
Sequence:CCGGCAACAAGAGTCTGTCCGTAAACTCGAGTTTACGGACAGACTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008784.1-1133s1c1
Sequence:CCGGCCATGGATGATGTTAAGGATACTCGAGTATCCTTAACATCATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-934s1c1
Sequence:CCGGGTCCTTACTGATCATTCTTTACTCGAGTAAAGAATGATCAGTAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-464s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-1012s1c1
Sequence:CCGGGAGGATAAATCATGTCAGAAACTCGAGTTTCTGACATGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008784
CD200R1L MISSION shRNA shRNA Plasmid DNA
CD200 receptor 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-873s1c1
Sequence:CCGGGCAACAAGAGTCTGTCCGTAACTCGAGTTACGGACAGACTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-877s1c1
Sequence:CCGGCAAGAGTCTGTCCGTAAAGTTCTCGAGAACTTTACGGACAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1044s1c1
Sequence:CCGGGAAGAAGGAAGGGTCTTCTTTCTCGAGAAAGAAGACCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1132s1c1
Sequence:CCGGGCCATGGATGATGTTAAGGATCTCGAGATCCTTAACATCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-874s1c1
Sequence:CCGGCAACAAGAGTCTGTCCGTAAACTCGAGTTTACGGACAGACTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008784.1-1133s1c1
Sequence:CCGGCCATGGATGATGTTAAGGATACTCGAGTATCCTTAACATCATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-934s1c1
Sequence:CCGGGTCCTTACTGATCATTCTTTACTCGAGTAAAGAATGATCAGTAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-464s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-1012s1c1
Sequence:CCGGGAGGATAAATCATGTCAGAAACTCGAGTTTCTGACATGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008784
CD200R1L MISSION shRNA Lentiviral Transduction Particles
CD200 receptor 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-873s1c1
Sequence:CCGGGCAACAAGAGTCTGTCCGTAACTCGAGTTACGGACAGACTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-877s1c1
Sequence:CCGGCAAGAGTCTGTCCGTAAAGTTCTCGAGAACTTTACGGACAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1044s1c1
Sequence:CCGGGAAGAAGGAAGGGTCTTCTTTCTCGAGAAAGAAGACCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008784.1-1132s1c1
Sequence:CCGGGCCATGGATGATGTTAAGGATCTCGAGATCCTTAACATCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008784.1-874s1c1
Sequence:CCGGCAACAAGAGTCTGTCCGTAAACTCGAGTTTACGGACAGACTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008784.1-1133s1c1
Sequence:CCGGCCATGGATGATGTTAAGGATACTCGAGTATCCTTAACATCATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-934s1c1
Sequence:CCGGGTCCTTACTGATCATTCTTTACTCGAGTAAAGAATGATCAGTAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-464s1c1
Sequence:CCGGGCCTACAAGAAAGAAACAAATCTCGAGATTTGTTTCTTTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008784.1-1012s1c1
Sequence:CCGGGAGGATAAATCATGTCAGAAACTCGAGTTTCTGACATGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks