EMAIL THIS PAGE TO A FRIEND

CD207

CD207 molecule, langerin

70 Gene Product Result for
Synonyms: CLEC4K
UniProtKB ID: Q9UJ71
Gene ID:
Human(50489) Summary: The protein encoded by this gene is expressed only in Langerhans cells which are immature dendritic cells of the epidermis and mucosa. It is localized in the Birbeck granules, organelles present in the cytoplasm of Langerhans cells and consisting of superimposed and zippered membranes. It is a C-type lectin with mannose binding specificity, and it has been proposed that mannose binding by this protein leads to internalization of antigen into Birbeck granules and providing access to a nonclassical antigen-processing pathway. Mutations in this gene result in Birbeck granules deficiency or loss of sugar binding activity. [provided by RefSeq, Aug 2010]
Mouse(246278) CD207 antigen
Rat(502852) CD207 molecule, langerin
naked mole-rat(101721714) CD207 molecule, langerin
domestic guinea pig(100717459) CD207 molecule, langerin
sheep(101107427) CD207 molecule, langerin
dog(612679) CD207 molecule, langerin
domestic cat(101098048) CD207 molecule, langerin
cow(511000) CD207 molecule, langerin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149991 MISSION® esiRNA esiRNA human CD207 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015717 Rosetta Predictions human pricing
XM_578352 Rosetta Predictions rat pricing
NM_144943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348401 predicted 1069
2 SASI_Hs02_00348402 predicted 690
3 SASI_Hs01_00184502 predicted 699
4 SASI_Hs01_00184503 predicted 472
5 SASI_Hs01_00184505 predicted 853
6 SASI_Hs01_00184506 predicted 389
7 SASI_Hs01_00184507 predicted 1113
8 SASI_Hs01_00184508 predicted 866
9 SASI_Hs02_00348403 predicted 904
10 SASI_Hs01_00184510 predicted 362
11 SASI_Hs01_00184504 predicted 246
12 SASI_Hs01_00184509 predicted 939
13 SASI_Hs01_00184511 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407784 predicted 391
2 SASI_Rn02_00407785 predicted 715
3 SASI_Rn02_00407786 predicted 317
4 SASI_Rn02_00407787 predicted 741
5 SASI_Rn02_00407788 predicted 417
6 SASI_Rn02_00407789 predicted 577
7 SASI_Rn02_00407790 predicted 684
8 SASI_Rn02_00407791 predicted 565
9 SASI_Rn02_00407792 predicted 740
10 SASI_Rn02_00407793 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081460 predicted 816
2 SASI_Mm01_00081461 predicted 461
3 SASI_Mm01_00081462 predicted 616
4 SASI_Mm01_00081463 predicted 456
5 SASI_Mm01_00081464 predicted 799
6 SASI_Mm01_00081465 predicted 230
7 SASI_Mm01_00081466 predicted 922
8 SASI_Mm01_00081467 predicted 1120
9 SASI_Mm01_00081468 predicted 613
10 SASI_Mm01_00081469 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015717
CD207 MISSION shRNA Bacterial Glycerol Stock
CD207 molecule, langerin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-856s1c1
Sequence:CCGGCGCCATTCAACAAGGTCCAAACTCGAGTTTGGACCTTGTTGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-1008s1c1
Sequence:CCGGCGACCCTATGTCCCATCAGAACTCGAGTTCTGATGGGACATAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-241s1c1
Sequence:CCGGCCCGGTTTATGGGCACCATATCTCGAGATATGGTGCCCATAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-404s1c1
Sequence:CCGGGCGTTCTCAGTTCCTGAAGTTCTCGAGAACTTCAGGAACTGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-313s1c1
Sequence:CCGGGCACCCTGGATTCTGAAATTACTCGAGTAATTTCAGAATCCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015717.2-922s21c1
Sequence:CCGGATGAACACTGTGGCAATATAACTCGAGTTATATTGCCACAGTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015717
CD207 MISSION shRNA shRNA Plasmid DNA
CD207 molecule, langerin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-856s1c1
Sequence:CCGGCGCCATTCAACAAGGTCCAAACTCGAGTTTGGACCTTGTTGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-1008s1c1
Sequence:CCGGCGACCCTATGTCCCATCAGAACTCGAGTTCTGATGGGACATAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-241s1c1
Sequence:CCGGCCCGGTTTATGGGCACCATATCTCGAGATATGGTGCCCATAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-404s1c1
Sequence:CCGGGCGTTCTCAGTTCCTGAAGTTCTCGAGAACTTCAGGAACTGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-313s1c1
Sequence:CCGGGCACCCTGGATTCTGAAATTACTCGAGTAATTTCAGAATCCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015717.2-922s21c1
Sequence:CCGGATGAACACTGTGGCAATATAACTCGAGTTATATTGCCACAGTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015717
CD207 MISSION shRNA Lentiviral Transduction Particles
CD207 molecule, langerin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-856s1c1
Sequence:CCGGCGCCATTCAACAAGGTCCAAACTCGAGTTTGGACCTTGTTGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-1008s1c1
Sequence:CCGGCGACCCTATGTCCCATCAGAACTCGAGTTCTGATGGGACATAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-241s1c1
Sequence:CCGGCCCGGTTTATGGGCACCATATCTCGAGATATGGTGCCCATAAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-404s1c1
Sequence:CCGGGCGTTCTCAGTTCCTGAAGTTCTCGAGAACTTCAGGAACTGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015717.1-313s1c1
Sequence:CCGGGCACCCTGGATTCTGAAATTACTCGAGTAATTTCAGAATCCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015717.2-922s21c1
Sequence:CCGGATGAACACTGTGGCAATATAACTCGAGTTATATTGCCACAGTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144943
CD207 MISSION shRNA Bacterial Glycerol Stock
CD207 molecule, langerin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-1032s1c1
Sequence:CCGGCCTACGTCCAAACAACTGAATCTCGAGATTCAGTTGTTTGGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-619s1c1
Sequence:CCGGGCTCAAACAACAGAGTGACATCTCGAGATGTCACTCTGTTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-380s1c1
Sequence:CCGGGCTGAGGTTCAGATGCAGATACTCGAGTATCTGCATCTGAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-892s1c1
Sequence:CCGGGCAAAGTAGGAGGTTCTGGATCTCGAGATCCAGAACCTCCTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-464s1c1
Sequence:CCGGGCCAATGATCAGCTCCAGATACTCGAGTATCTGGAGCTGATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144943
CD207 MISSION shRNA shRNA Plasmid DNA
CD207 molecule, langerin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-1032s1c1
Sequence:CCGGCCTACGTCCAAACAACTGAATCTCGAGATTCAGTTGTTTGGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-619s1c1
Sequence:CCGGGCTCAAACAACAGAGTGACATCTCGAGATGTCACTCTGTTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-380s1c1
Sequence:CCGGGCTGAGGTTCAGATGCAGATACTCGAGTATCTGCATCTGAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-892s1c1
Sequence:CCGGGCAAAGTAGGAGGTTCTGGATCTCGAGATCCAGAACCTCCTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-464s1c1
Sequence:CCGGGCCAATGATCAGCTCCAGATACTCGAGTATCTGGAGCTGATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144943
CD207 MISSION shRNA Lentiviral Transduction Particles
CD207 molecule, langerin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-1032s1c1
Sequence:CCGGCCTACGTCCAAACAACTGAATCTCGAGATTCAGTTGTTTGGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-619s1c1
Sequence:CCGGGCTCAAACAACAGAGTGACATCTCGAGATGTCACTCTGTTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-380s1c1
Sequence:CCGGGCTGAGGTTCAGATGCAGATACTCGAGTATCTGCATCTGAACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-892s1c1
Sequence:CCGGGCAAAGTAGGAGGTTCTGGATCTCGAGATCCAGAACCTCCTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144943.2-464s1c1
Sequence:CCGGGCCAATGATCAGCTCCAGATACTCGAGTATCTGGAGCTGATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks