EMAIL THIS PAGE TO A FRIEND

CD209

CD209 molecule

114 Gene Product Result for
Synonyms: CDSIGN CLEC4L DC-SIGN DC-SIGN1
Gene ID:
Human(30835) Summary: This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Zebrafish(100334918) CD209 molecule
cow(513266) CD209 molecule
domestic cat(100462978) CD209 molecule
dog(485000) CD209 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407409 Anti-CD209 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4300650 Anti-CD209 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1410626 Anti-CD209 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
PRS2347 Anti-DC-SIGN (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS2349 Anti-DC-SIGN (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403221 Monoclonal Anti-CD209 antibody produced in mouse clone 3B10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4700745 Monoclonal Anti-CD209 antibody produced in mouse clone UW60.1, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry pricing
SAB4700690 Monoclonal Anti-CD209-PE antibody produced in mouse clone UW60.1, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry pricing
D2191 Monoclonal Anti-DC-SIGN1 antibody produced in mouse clone 120507, purified immunoglobulin, lyophilized powder human
flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing
D2691 Monoclonal Anti-DC-SIGN1/DC-SIGN2 antibody produced in mouse clone 120612, purified immunoglobulin, lyophilized powder human
flow cytometry, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021155 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159851 MISSION® esiRNA esiRNA human CD209 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021155 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234708 predicted 1017
2 SASI_Hs01_00234709 predicted 1299
3 SASI_Hs01_00234710 predicted 1022
4 SASI_Hs01_00234711 predicted 1286
5 SASI_Hs01_00234712 predicted 1158
6 SASI_Hs01_00234713 predicted 1301
7 SASI_Hs01_00234714 predicted 568
8 SASI_Hs01_00234715 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021155
CD209 MISSION shRNA Bacterial Glycerol Stock
CD209 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1349s21c1
Sequence:CCGGGGACTGTTCTTTGTCAGATTCCTCGAGGAATCTGACAAAGAACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021155.3-280s21c1
Sequence:CCGGATCCAGGCAAGACGCGATCTACTCGAGTAGATCGCGTCTTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1666s21c1
Sequence:CCGGACTGGTTGCAAGAGCTCATTTCTCGAGAAATGAGCTCTTGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1107s1c1
Sequence:CCGGCGACAAATGTAATCTTGCCAACTCGAGTTGGCAAGATTACATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-94s1c1
Sequence:CCGGCGAGGATACAAGAGCTTAGCACTCGAGTGCTAAGCTCTTGTATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1029s1c1
Sequence:CCGGGCAGTATTGGAACAGAGGAGACTCGAGTCTCCTCTGTTCCAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1162s1c1
Sequence:CCGGTCCAGGGATGAAGAACAGTTTCTCGAGAAACTGTTCTTCATCCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-486s1c1
Sequence:CCGGGCTTCCAGAGAAATCTAAGATCTCGAGATCTTAGATTTCTCTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021155
CD209 MISSION shRNA shRNA Plasmid DNA
CD209 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1349s21c1
Sequence:CCGGGGACTGTTCTTTGTCAGATTCCTCGAGGAATCTGACAAAGAACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021155.3-280s21c1
Sequence:CCGGATCCAGGCAAGACGCGATCTACTCGAGTAGATCGCGTCTTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1666s21c1
Sequence:CCGGACTGGTTGCAAGAGCTCATTTCTCGAGAAATGAGCTCTTGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1107s1c1
Sequence:CCGGCGACAAATGTAATCTTGCCAACTCGAGTTGGCAAGATTACATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-94s1c1
Sequence:CCGGCGAGGATACAAGAGCTTAGCACTCGAGTGCTAAGCTCTTGTATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1029s1c1
Sequence:CCGGGCAGTATTGGAACAGAGGAGACTCGAGTCTCCTCTGTTCCAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1162s1c1
Sequence:CCGGTCCAGGGATGAAGAACAGTTTCTCGAGAAACTGTTCTTCATCCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-486s1c1
Sequence:CCGGGCTTCCAGAGAAATCTAAGATCTCGAGATCTTAGATTTCTCTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021155
CD209 MISSION shRNA Lentiviral Transduction Particles
CD209 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1349s21c1
Sequence:CCGGGGACTGTTCTTTGTCAGATTCCTCGAGGAATCTGACAAAGAACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021155.3-280s21c1
Sequence:CCGGATCCAGGCAAGACGCGATCTACTCGAGTAGATCGCGTCTTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021155.3-1666s21c1
Sequence:CCGGACTGGTTGCAAGAGCTCATTTCTCGAGAAATGAGCTCTTGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1107s1c1
Sequence:CCGGCGACAAATGTAATCTTGCCAACTCGAGTTGGCAAGATTACATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-94s1c1
Sequence:CCGGCGAGGATACAAGAGCTTAGCACTCGAGTGCTAAGCTCTTGTATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1029s1c1
Sequence:CCGGGCAGTATTGGAACAGAGGAGACTCGAGTCTCCTCTGTTCCAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-1162s1c1
Sequence:CCGGTCCAGGGATGAAGAACAGTTTCTCGAGAAACTGTTCTTCATCCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021155.2-486s1c1
Sequence:CCGGGCTTCCAGAGAAATCTAAGATCTCGAGATCTTAGATTTCTCTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks