EMAIL THIS PAGE TO A FRIEND

CD22

CD22 molecule

83 Gene Product Result for
Synonyms: SIGLEC-2 SIGLEC2
Gene ID:
Mouse(12483) CD22 antigen
Rat(308501) CD22 molecule
sheep(101102835) CD22 molecule
Zebrafish(554810) cd22 molecule
domestic cat(100113477) CD22 molecule
cow(514582) CD22 molecule
Horse(100146402) CD22 molecule
domestic cat(101081100) CD22 molecule
dog(476485) CD22 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503623 Anti-BL-CAM, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA024353 Anti-CD22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300687 Anti-CD22 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5500052 Anti-CD22 antibody, Rabbit monoclonal clone SP104, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4504665 Anti-phospho-BL-CAM (pTyr807) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301324 Anti-phospho-BL-CAM (pTyr807) antibody produced in rabbit affinity isolated antibody human
western blot pricing
C8464 Monoclonal Anti-CD22 antibody produced in mouse clone HIB22, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry pricing
SAB4700126 Monoclonal Anti-CD22 antibody produced in mouse clone MEM-01, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700122 Monoclonal Anti-CD22 azide free antibody produced in mouse clone IS7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700123 Monoclonal Anti-CD22-APC antibody produced in mouse clone IS7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700128 Monoclonal Anti-CD22-Biotin antibody produced in mouse clone MEM-01, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700124 Monoclonal Anti-CD22-FITC antibody produced in mouse clone IS7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700125 Monoclonal Anti-CD22-PE antibody produced in mouse clone IS7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700130 Monoclonal Anti-CD22-PE antibody produced in mouse clone MEM-01, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076411 MISSION® esiRNA esiRNA human CD22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001771 Rosetta Predictions human pricing
NM_001107503 Rosetta Predictions rat pricing
NM_001043317 Rosetta Predictions mouse pricing
NM_009845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207843 predicted 1418
2 SASI_Hs01_00207844 predicted 477
3 SASI_Hs01_00207845 predicted 1759
4 SASI_Hs01_00207846 predicted 1120
5 SASI_Hs01_00207847 predicted 2378
6 SASI_Hs01_00207848 predicted 1204
7 SASI_Hs01_00207849 predicted 934
8 SASI_Hs01_00207850 predicted 2327
9 SASI_Hs01_00207851 predicted 753
10 SASI_Hs01_00207852 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229465 predicted 2914
2 SASI_Rn02_00229466 predicted 602
3 SASI_Rn02_00229467 predicted 2707
4 SASI_Rn02_00229468 predicted 1382
5 SASI_Rn02_00229469 predicted 1538
6 SASI_Rn02_00229470 predicted 2753
7 SASI_Rn02_00229471 predicted 2785
8 SASI_Rn02_00229472 predicted 894
9 SASI_Rn02_00229473 predicted 2956
10 SASI_Rn02_00229474 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291155 predicted 1294
2 SASI_Mm02_00291156 predicted 989
3 SASI_Mm02_00291157 predicted 1043
4 SASI_Mm02_00291158 predicted 895
5 SASI_Mm02_00291159 predicted 2114
6 SASI_Mm02_00291160 predicted 1697
7 SASI_Mm02_00291161 predicted 835
8 SASI_Mm02_00291162 predicted 1460
9 SASI_Mm02_00291163 predicted 2451
10 SASI_Mm02_00291164 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062386 predicted 1515
2 SASI_Mm01_00062387 predicted 1208
3 SASI_Mm01_00062388 predicted 1265
4 SASI_Mm02_00317215 predicted 1110
5 SASI_Mm01_00062389 predicted 2332
6 SASI_Mm01_00062391 predicted 1918
7 SASI_Mm01_00062394 predicted 1052
8 SASI_Mm02_00317216 predicted 1684
9 SASI_Mm02_00317217 predicted 2668
10 SASI_Mm02_00317218 predicted 1515
11 SASI_Mm01_00062385 predicted 732
12 SASI_Mm01_00062390 predicted 3006
13 SASI_Mm01_00062392 predicted 3061
14 SASI_Mm01_00062393 predicted 1324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001771
CD22 MISSION shRNA Bacterial Glycerol Stock
CD22 molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001771.2-2966s21c1
Sequence:CCGGGGGATCTGCTCGTCATCATTTCTCGAGAAATGATGACGAGCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001771.2-2445s21c1
Sequence:CCGGTGCGATGACACGGTCACTTATCTCGAGATAAGTGACCGTGTCATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-920s1c1
Sequence:CCGGGCAGAATACATTCACGCTAAACTCGAGTTTAGCGTGAATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2074s1c1
Sequence:CCGGGCACCCTTACTGTCTACTATACTCGAGTATAGTAGACAGTAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-259s1c1
Sequence:CCGGCCTCGAAGTTTGATGGGACAACTCGAGTTGTCCCATCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-1126s1c1
Sequence:CCGGCCAATCCTCTTCCAACAAATTCTCGAGAATTTGTTGGAAGAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2300s1c1
Sequence:CCGGCCTGGGATGCTACAATCCAATCTCGAGATTGGATTGTAGCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001771
CD22 MISSION shRNA shRNA Plasmid DNA
CD22 molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001771.2-2966s21c1
Sequence:CCGGGGGATCTGCTCGTCATCATTTCTCGAGAAATGATGACGAGCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001771.2-2445s21c1
Sequence:CCGGTGCGATGACACGGTCACTTATCTCGAGATAAGTGACCGTGTCATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-920s1c1
Sequence:CCGGGCAGAATACATTCACGCTAAACTCGAGTTTAGCGTGAATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2074s1c1
Sequence:CCGGGCACCCTTACTGTCTACTATACTCGAGTATAGTAGACAGTAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-259s1c1
Sequence:CCGGCCTCGAAGTTTGATGGGACAACTCGAGTTGTCCCATCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-1126s1c1
Sequence:CCGGCCAATCCTCTTCCAACAAATTCTCGAGAATTTGTTGGAAGAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2300s1c1
Sequence:CCGGCCTGGGATGCTACAATCCAATCTCGAGATTGGATTGTAGCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001771
CD22 MISSION shRNA Lentiviral Transduction Particles
CD22 molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001771.2-2966s21c1
Sequence:CCGGGGGATCTGCTCGTCATCATTTCTCGAGAAATGATGACGAGCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001771.2-2445s21c1
Sequence:CCGGTGCGATGACACGGTCACTTATCTCGAGATAAGTGACCGTGTCATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-920s1c1
Sequence:CCGGGCAGAATACATTCACGCTAAACTCGAGTTTAGCGTGAATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2074s1c1
Sequence:CCGGGCACCCTTACTGTCTACTATACTCGAGTATAGTAGACAGTAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-259s1c1
Sequence:CCGGCCTCGAAGTTTGATGGGACAACTCGAGTTGTCCCATCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-1126s1c1
Sequence:CCGGCCAATCCTCTTCCAACAAATTCTCGAGAATTTGTTGGAAGAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001771.1-2300s1c1
Sequence:CCGGCCTGGGATGCTACAATCCAATCTCGAGATTGGATTGTAGCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009845
CD22 MISSION shRNA Bacterial Glycerol Stock
CD22 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1112s1c1
Sequence:CCGGCCTCCATTAAGAATGTCTATACTCGAGTATAGACATTCTTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-716s1c1
Sequence:CCGGCCACCAAGAAATTCAAAGGAACTCGAGTTCCTTTGAATTTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-3055s1c1
Sequence:CCGGGCAAAGGAAGACGTAGACTATCTCGAGATAGTCTACGTCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1630s1c1
Sequence:CCGGGCAACAAACTACACCTGGTATCTCGAGATACCAGGTGTAGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-2235s1c1
Sequence:CCGGCCCAGAAGATTCTGGAAATTACTCGAGTAATTTCCAGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009845
CD22 MISSION shRNA shRNA Plasmid DNA
CD22 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1112s1c1
Sequence:CCGGCCTCCATTAAGAATGTCTATACTCGAGTATAGACATTCTTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-716s1c1
Sequence:CCGGCCACCAAGAAATTCAAAGGAACTCGAGTTCCTTTGAATTTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-3055s1c1
Sequence:CCGGGCAAAGGAAGACGTAGACTATCTCGAGATAGTCTACGTCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1630s1c1
Sequence:CCGGGCAACAAACTACACCTGGTATCTCGAGATACCAGGTGTAGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-2235s1c1
Sequence:CCGGCCCAGAAGATTCTGGAAATTACTCGAGTAATTTCCAGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009845
CD22 MISSION shRNA Lentiviral Transduction Particles
CD22 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1112s1c1
Sequence:CCGGCCTCCATTAAGAATGTCTATACTCGAGTATAGACATTCTTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-716s1c1
Sequence:CCGGCCACCAAGAAATTCAAAGGAACTCGAGTTCCTTTGAATTTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-3055s1c1
Sequence:CCGGGCAAAGGAAGACGTAGACTATCTCGAGATAGTCTACGTCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-1630s1c1
Sequence:CCGGGCAACAAACTACACCTGGTATCTCGAGATACCAGGTGTAGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009845.1-2235s1c1
Sequence:CCGGCCCAGAAGATTCTGGAAATTACTCGAGTAATTTCCAGAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks