EMAIL THIS PAGE TO A FRIEND

CD247

CD247 molecule

131 Gene Product Result for
Synonyms: CD3-ZETA CD3H CD3Q CD3Z T3Z TCRZ
UniProtKB ID: P20963, B1AK49, Q5VX13, Q8TAX4
Gene ID:
Human(919) Summary: The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12503) CD247 antigen
Rat(25300) Cd247 molecule
sheep(443436) CD247 molecule
naked mole-rat(101714962) CD247 molecule
Zebrafish(100101654) CD247 antigen
chicken(395911) CD247 molecule
dog(611571) CD247 molecule
domestic cat(101080604) CD247 molecule
cow(281056) CD247 molecule
Horse(100051432) CD247 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008750 Anti-CD247 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411621 Anti-CD247 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4503580 Anti-CD3 ζ, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1305733 ANTI-CD3Z(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306127 ANTI-CD3Z(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4503906 Anti-phospho-CD3 ζ (pTyr142) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301233 Anti-phospho-CD3 ζ (pTyr142) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4200332 Anti-phospho-CD3ζ (pTyr111) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse
immunoprecipitation, western blot pricing
SAB4200333 Anti-phospho-CD3ζ (pTyr123) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse
immunoprecipitation, western blot pricing
SAB4200334 Anti-phospho-CD3ζ (pTyr142) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse
immunoprecipitation, western blot pricing
SAB4200335 Anti-phospho-CD3ζ (pTyr153) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse
immunoprecipitation, western blot pricing
SAB4200330 Anti-phospho-CD3ζ (pTyr72) antibody produced in rabbit IgG fraction of antiserum mouse
immunoprecipitation, western blot pricing
SAB4200331 Anti-phospho-CD3ζ (pTyr83) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse
immunoprecipitation, western blot pricing
SAB4700052 Monoclonal Anti-CD247 azide free antibody produced in hamster clone H146-968, purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB4700053 Monoclonal Anti-CD247-FITC antibody produced in hamster clone H146-968, purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry pricing
SAB4200446 Monoclonal Anti-CD3 ζ chain antibody produced in mouse ~1.0 mg/mL, clone ZT-10, purified immunoglobulin human, mouse
flow cytometry, immunofluorescence pricing
WH0000919M1 Monoclonal Anti-CD3Z antibody produced in mouse clone 4A12-F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4200219 Monoclonal Anti-CD3ζ chain antibody produced in hamster ~1.0 mg/mL, clone H146-968, purified immunoglobulin human, mouse
flow cytometry, immunocytochemistry, immunoprecipitation, western blot pricing
SAB4200229 Monoclonal Anti-CD3ζ chain antibody produced in mouse ~1.0 mg/mL, clone TCR48, purified immunoglobulin human, mouse
immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000734 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159661 MISSION® esiRNA esiRNA human CD247 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000734 Rosetta Predictions human pricing
NM_198053 Rosetta Predictions human pricing
NM_170789 Rosetta Predictions rat pricing
NM_001113391 Rosetta Predictions mouse pricing
NM_001113392 Rosetta Predictions mouse pricing
NM_001113393 Rosetta Predictions mouse pricing
NM_001113394 Rosetta Predictions mouse pricing
NM_031162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221432 predicted 1036
2 SASI_Hs01_00221433 predicted 939
3 SASI_Hs01_00221434 predicted 834
4 SASI_Hs01_00221435 predicted 974
5 SASI_Hs01_00221436 predicted 704
6 SASI_Hs01_00221438 predicted 939
7 SASI_Hs01_00221439 predicted 1036
8 SASI_Hs02_00303160 predicted 685
9 SASI_Hs02_00303161 predicted 930
10 SASI_Hs02_00303162 predicted 1016
11 SASI_Hs01_00221437 predicted 983
12 SASI_Hs01_00221440 predicted 991
13 SASI_Hs01_00221441 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099591 predicted 1040
2 SASI_Hs01_00099592 predicted 946
3 SASI_Hs01_00099593 predicted 838
4 SASI_Hs01_00099594 predicted 980
5 SASI_Hs01_00099595 predicted 698
6 SASI_Hs01_00099597 predicted 950
7 SASI_Hs01_00099598 predicted 1038
8 SASI_Hs02_00371607 predicted 690
9 SASI_Hs02_00371608 predicted 942
10 SASI_Hs02_00371609 predicted 1025
11 SASI_Hs01_00099596 predicted 980
12 SASI_Hs01_00099599 predicted 994
13 SASI_Hs01_00099600 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269068 predicted 1006
2 SASI_Rn02_00269069 predicted 684
3 SASI_Rn02_00269070 predicted 1067
4 SASI_Rn02_00269071 predicted 198
5 SASI_Rn02_00269072 predicted 985
6 SASI_Rn02_00269073 predicted 681
7 SASI_Rn02_00269074 predicted 990
8 SASI_Rn02_00269075 predicted 1018
9 SASI_Rn02_00269076 predicted 739
10 SASI_Rn02_00269077 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307668 predicted 272
2 SASI_Mm02_00307669 predicted 228
3 SASI_Mm02_00307670 predicted 224
4 SASI_Mm02_00307671 predicted 232
5 SASI_Mm02_00307672 predicted 346
6 SASI_Mm02_00307673 predicted 232
7 SASI_Mm02_00307674 predicted 236
8 SASI_Mm02_00307675 predicted 241
9 SASI_Mm02_00307676 predicted 346
10 SASI_Mm02_00307677 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307678 predicted 273
2 SASI_Mm02_00307679 predicted 229
3 SASI_Mm02_00307680 predicted 219
4 SASI_Mm02_00307681 predicted 231
5 SASI_Mm02_00307682 predicted 343
6 SASI_Mm02_00307683 predicted 229
7 SASI_Mm02_00307684 predicted 237
8 SASI_Mm02_00307685 predicted 237
9 SASI_Mm02_00307686 predicted 342
10 SASI_Mm02_00307687 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307688 predicted 278
2 SASI_Mm02_00307689 predicted 229
3 SASI_Mm02_00307690 predicted 220
4 SASI_Mm02_00307691 predicted 228
5 SASI_Mm02_00307692 predicted 344
6 SASI_Mm02_00307693 predicted 229
7 SASI_Mm02_00307694 predicted 244
8 SASI_Mm02_00307695 predicted 242
9 SASI_Mm02_00307696 predicted 345
10 SASI_Mm02_00307697 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307698 predicted 273
2 SASI_Mm02_00307699 predicted 229
3 SASI_Mm02_00307700 predicted 224
4 SASI_Mm02_00307701 predicted 230
5 SASI_Mm02_00307702 predicted 347
6 SASI_Mm02_00307703 predicted 223
7 SASI_Mm02_00307704 predicted 240
8 SASI_Mm02_00307705 predicted 242
9 SASI_Mm02_00307706 predicted 342
10 SASI_Mm02_00307707 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336974 predicted 273
2 SASI_Mm02_00336975 predicted 223
3 SASI_Mm01_00190750 predicted 220
4 SASI_Mm02_00336976 predicted 233
5 SASI_Mm01_00190752 predicted 338
6 SASI_Mm01_00190753 predicted 230
7 SASI_Mm01_00190754 predicted 240
8 SASI_Mm02_00336977 predicted 242
9 SASI_Mm02_00336978 predicted 343
10 SASI_Mm02_00336979 predicted 229
11 SASI_Mm01_00190749 predicted 467
12 SASI_Mm01_00190751 predicted 625
13 SASI_Mm01_00190755 predicted 579
14 SASI_Mm01_00190756 predicted 492
15 SASI_Mm01_00190757 predicted 674
16 SASI_Mm01_00190758 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000734
CD247 MISSION shRNA Bacterial Glycerol Stock
CD247 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-487s1c1
Sequence:CCGGCTACAGTGAGATTGGGATGAACTCGAGTTCATCCCAATCTCACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-463s1c1
Sequence:CCGGGCAGAAAGATAAGATGGCGGACTCGAGTCCGCCATCTTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-359s1c1
Sequence:CCGGCGAAGAGAGGAGTACGATGTTCTCGAGAACATCGTACTCCTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-268s1c1
Sequence:CCGGCTTGTTCCTGAGAGTGAAGTTCTCGAGAACTTCACTCTCAGGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-331s1c1
Sequence:CCGGCCAGCTCTATAACGAGCTCAACTCGAGTTGAGCTCGTTATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000734
CD247 MISSION shRNA shRNA Plasmid DNA
CD247 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-487s1c1
Sequence:CCGGCTACAGTGAGATTGGGATGAACTCGAGTTCATCCCAATCTCACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-463s1c1
Sequence:CCGGGCAGAAAGATAAGATGGCGGACTCGAGTCCGCCATCTTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-359s1c1
Sequence:CCGGCGAAGAGAGGAGTACGATGTTCTCGAGAACATCGTACTCCTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-268s1c1
Sequence:CCGGCTTGTTCCTGAGAGTGAAGTTCTCGAGAACTTCACTCTCAGGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-331s1c1
Sequence:CCGGCCAGCTCTATAACGAGCTCAACTCGAGTTGAGCTCGTTATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000734
CD247 MISSION shRNA Lentiviral Transduction Particles
CD247 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-487s1c1
Sequence:CCGGCTACAGTGAGATTGGGATGAACTCGAGTTCATCCCAATCTCACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-463s1c1
Sequence:CCGGGCAGAAAGATAAGATGGCGGACTCGAGTCCGCCATCTTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-359s1c1
Sequence:CCGGCGAAGAGAGGAGTACGATGTTCTCGAGAACATCGTACTCCTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-268s1c1
Sequence:CCGGCTTGTTCCTGAGAGTGAAGTTCTCGAGAACTTCACTCTCAGGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000734.2-331s1c1
Sequence:CCGGCCAGCTCTATAACGAGCTCAACTCGAGTTGAGCTCGTTATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031162
CD247 MISSION shRNA Bacterial Glycerol Stock
CD247 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-465s1c1
Sequence:CCGGCGTATACAATGCACTGCAGAACTCGAGTTCTGCAGTGCATTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-684s1c1
Sequence:CCGGCCAATCCTGTGCCAGCGTCTTCTCGAGAAGACGCTGGCACAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-240s1c1
Sequence:CCGGGCTAGATGGAATCCTCTTCATCTCGAGATGAAGAGGATTCCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-252s1c1
Sequence:CCGGCCTCTTCATCTACGGAGTCATCTCGAGATGACTCCGTAGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-349s1c1
Sequence:CCGGCTCTACAATGAGCTCAATCTACTCGAGTAGATTGAGCTCATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031162
CD247 MISSION shRNA shRNA Plasmid DNA
CD247 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-465s1c1
Sequence:CCGGCGTATACAATGCACTGCAGAACTCGAGTTCTGCAGTGCATTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-684s1c1
Sequence:CCGGCCAATCCTGTGCCAGCGTCTTCTCGAGAAGACGCTGGCACAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-240s1c1
Sequence:CCGGGCTAGATGGAATCCTCTTCATCTCGAGATGAAGAGGATTCCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-252s1c1
Sequence:CCGGCCTCTTCATCTACGGAGTCATCTCGAGATGACTCCGTAGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-349s1c1
Sequence:CCGGCTCTACAATGAGCTCAATCTACTCGAGTAGATTGAGCTCATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031162
CD247 MISSION shRNA Lentiviral Transduction Particles
CD247 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-465s1c1
Sequence:CCGGCGTATACAATGCACTGCAGAACTCGAGTTCTGCAGTGCATTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-684s1c1
Sequence:CCGGCCAATCCTGTGCCAGCGTCTTCTCGAGAAGACGCTGGCACAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-240s1c1
Sequence:CCGGGCTAGATGGAATCCTCTTCATCTCGAGATGAAGAGGATTCCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-252s1c1
Sequence:CCGGCCTCTTCATCTACGGAGTCATCTCGAGATGACTCCGTAGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031162.1-349s1c1
Sequence:CCGGCTCTACAATGAGCTCAATCTACTCGAGTAGATTGAGCTCATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks