EMAIL THIS PAGE TO A FRIEND

CD248

CD248 molecule, endosialin

65 Gene Product Result for
Synonyms: CD164L1 TEM1
UniProtKB ID: Q9HCU0, Q2M2V5, Q3SX55, Q96KB6
Gene ID:
Mouse(70445) CD248 antigen, endosialin
Rat(293669) CD248 molecule, endosialin
cow(520070) CD248 molecule, endosialin
domestic cat(101083801) CD248 molecule, endosialin
dog(483712) CD248 molecule, endosialin
domestic guinea pig(100714474) CD248 molecule, endosialin
naked mole-rat(101697499) CD248 molecule, endosialin
sheep(101105455) CD248 molecule, endosialin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020404 Rosetta Predictions human pricing
NM_001106325 Rosetta Predictions rat pricing
NM_054042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065080 predicted 1220
2 SASI_Hs01_00065081 predicted 2163
3 SASI_Hs01_00065082 predicted 538
4 SASI_Hs01_00065083 predicted 1018
5 SASI_Hs01_00065085 predicted 1493
6 SASI_Hs01_00065086 predicted 1640
7 SASI_Hs02_00353388 predicted 1249
8 SASI_Hs01_00065088 predicted 2205
9 SASI_Hs01_00065089 predicted 1468
10 SASI_Hs02_00353389 predicted 925
11 SASI_Hs01_00065084 predicted 871
12 SASI_Hs01_00065087 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217858 predicted 2213
2 SASI_Rn02_00217859 predicted 1027
3 SASI_Rn02_00217860 predicted 1704
4 SASI_Rn02_00217861 predicted 574
5 SASI_Rn02_00217862 predicted 676
6 SASI_Rn02_00217863 predicted 1252
7 SASI_Rn02_00217864 predicted 1429
8 SASI_Rn02_00217865 predicted 590
9 SASI_Rn02_00217866 predicted 799
10 SASI_Rn02_00217867 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021734 predicted 1432
2 SASI_Mm01_00021735 predicted 577
3 SASI_Mm01_00021736 predicted 2217
4 SASI_Mm01_00021738 predicted 1257
5 SASI_Mm01_00021739 predicted 1683
6 SASI_Mm01_00021740 predicted 2240
7 SASI_Mm01_00021741 predicted 1703
8 SASI_Mm01_00021742 predicted 1437
9 SASI_Mm01_00021743 predicted 1197
10 SASI_Mm02_00337948 predicted 1952
11 SASI_Mm01_00021737 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054042
CD248 MISSION shRNA Bacterial Glycerol Stock
CD248 molecule, endosialin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1639s1c1
Sequence:CCGGCCCATTATCTCAACCAACTATCTCGAGATAGTTGGTTGAGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1556s1c1
Sequence:CCGGCCAATTATCCAGACCTGCCTTCTCGAGAAGGCAGGTCTGGATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054042.2-2443s1c1
Sequence:CCGGACAGAGGAGGTTCTGTTCTTTCTCGAGAAAGAACAGAACCTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1435s1c1
Sequence:CCGGGCCCACAAGACCTCTGTTATTCTCGAGAATAACAGAGGTCTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-576s1c1
Sequence:CCGGCGCTGTCTACACCACACCCTTCTCGAGAAGGGTGTGGTGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054042
CD248 MISSION shRNA shRNA Plasmid DNA
CD248 molecule, endosialin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1639s1c1
Sequence:CCGGCCCATTATCTCAACCAACTATCTCGAGATAGTTGGTTGAGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1556s1c1
Sequence:CCGGCCAATTATCCAGACCTGCCTTCTCGAGAAGGCAGGTCTGGATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054042.2-2443s1c1
Sequence:CCGGACAGAGGAGGTTCTGTTCTTTCTCGAGAAAGAACAGAACCTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1435s1c1
Sequence:CCGGGCCCACAAGACCTCTGTTATTCTCGAGAATAACAGAGGTCTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-576s1c1
Sequence:CCGGCGCTGTCTACACCACACCCTTCTCGAGAAGGGTGTGGTGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054042
CD248 MISSION shRNA Lentiviral Transduction Particles
CD248 molecule, endosialin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1639s1c1
Sequence:CCGGCCCATTATCTCAACCAACTATCTCGAGATAGTTGGTTGAGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1556s1c1
Sequence:CCGGCCAATTATCCAGACCTGCCTTCTCGAGAAGGCAGGTCTGGATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054042.2-2443s1c1
Sequence:CCGGACAGAGGAGGTTCTGTTCTTTCTCGAGAAAGAACAGAACCTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-1435s1c1
Sequence:CCGGGCCCACAAGACCTCTGTTATTCTCGAGAATAACAGAGGTCTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054042.2-576s1c1
Sequence:CCGGCGCTGTCTACACCACACCCTTCTCGAGAAGGGTGTGGTGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020404
CD248 MISSION shRNA Bacterial Glycerol Stock
CD248 molecule, endosialin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1559s1c1
Sequence:CCGGCCCTATGATCTCAACCAAATACTCGAGTATTTGGTTGAGATCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1477s1c1
Sequence:CCGGCCAACTATCCAGATCTGCCTTCTCGAGAAGGCAGATCTGGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-951s1c1
Sequence:CCGGGACACAGATGAGTGCCAGATTCTCGAGAATCTGGCACTCATCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1646s1c1
Sequence:CCGGCACCACTCATTTGCCTGGAATCTCGAGATTCCAGGCAAATGAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-1908s21c1
Sequence:CCGGTCACCCATCAGCCCTACACATCTCGAGATGTGTAGGGCTGATGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-472s21c1
Sequence:CCGGACGGCTACCTGTGCCAGTTTGCTCGAGCAAACTGGCACAGGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-2176s21c1
Sequence:CCGGAGCGCATCACTGACTGCTATCCTCGAGGATAGCAGTCAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020404
CD248 MISSION shRNA shRNA Plasmid DNA
CD248 molecule, endosialin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1559s1c1
Sequence:CCGGCCCTATGATCTCAACCAAATACTCGAGTATTTGGTTGAGATCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1477s1c1
Sequence:CCGGCCAACTATCCAGATCTGCCTTCTCGAGAAGGCAGATCTGGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-951s1c1
Sequence:CCGGGACACAGATGAGTGCCAGATTCTCGAGAATCTGGCACTCATCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1646s1c1
Sequence:CCGGCACCACTCATTTGCCTGGAATCTCGAGATTCCAGGCAAATGAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-1908s21c1
Sequence:CCGGTCACCCATCAGCCCTACACATCTCGAGATGTGTAGGGCTGATGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-472s21c1
Sequence:CCGGACGGCTACCTGTGCCAGTTTGCTCGAGCAAACTGGCACAGGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-2176s21c1
Sequence:CCGGAGCGCATCACTGACTGCTATCCTCGAGGATAGCAGTCAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020404
CD248 MISSION shRNA Lentiviral Transduction Particles
CD248 molecule, endosialin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1559s1c1
Sequence:CCGGCCCTATGATCTCAACCAAATACTCGAGTATTTGGTTGAGATCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1477s1c1
Sequence:CCGGCCAACTATCCAGATCTGCCTTCTCGAGAAGGCAGATCTGGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-951s1c1
Sequence:CCGGGACACAGATGAGTGCCAGATTCTCGAGAATCTGGCACTCATCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020404.2-1646s1c1
Sequence:CCGGCACCACTCATTTGCCTGGAATCTCGAGATTCCAGGCAAATGAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-1908s21c1
Sequence:CCGGTCACCCATCAGCCCTACACATCTCGAGATGTGTAGGGCTGATGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-472s21c1
Sequence:CCGGACGGCTACCTGTGCCAGTTTGCTCGAGCAAACTGGCACAGGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020404.2-2176s21c1
Sequence:CCGGAGCGCATCACTGACTGCTATCCTCGAGGATAGCAGTCAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks