EMAIL THIS PAGE TO A FRIEND

CD24

CD24 molecule

142 Gene Product Result for
Synonyms: CD24A
UniProtKB ID: P25063, Q16257, Q53XS0
Gene ID:
Human(100133941) Summary: This gene encodes a sialoglycoprotein that is expressed on mature granulocytes and in many B cells. The encoded protein is anchored via a glycosyl phosphatidylinositol (GPI) link to the cell surface. [provided by RefSeq, Jul 2008]
Rat(25145) CD24 molecule
chicken(100859742) CD24 molecule
cow(100137875) CD24 molecule
cow(281049) CD24 antigen
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013230 Rosetta Predictions human pricing
XM_001725629 Rosetta Predictions human pricing
NM_012752 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232148 predicted 851
2 SASI_Hs01_00232149 predicted 836
3 SASI_Hs01_00232150 predicted 836
4 SASI_Hs02_00344414 predicted 613
5 SASI_Hs02_00344415 predicted 633
6 SASI_Hs01_00232147 predicted 450
7 SASI_Hs02_00344416 predicted 520
8 SASI_Hs02_00344417 predicted 699
9 SASI_Hs02_00344418 predicted 644
10 SASI_Hs02_00344419 predicted 732
11 SASI_Hs01_00232151 predicted 313
12 SASI_Hs01_00232152 predicted 258
13 SASI_Hs01_00232153 predicted 370
14 SASI_Hs01_00232154 predicted 342
15 SASI_Hs01_00232155 predicted 368
16 SASI_Hs01_00232156 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00468963 predicted 1367
2 SASI_Hs02_00468964 predicted 979
3 SASI_Hs02_00468965 predicted 1068
4 SASI_Hs02_00468966 predicted 1159
5 SASI_Hs02_00468967 predicted 1049
6 SASI_Hs02_00468968 predicted 1229
7 SASI_Hs02_00468969 predicted 1168
8 SASI_Hs02_00468970 predicted 1022
9 SASI_Hs02_00468971 predicted 1260
10 SASI_Hs02_00468972 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041680 predicted 609
2 SASI_Rn01_00041681 predicted 762
3 SASI_Rn01_00041682 predicted 710
4 SASI_Rn01_00041683 predicted 571
5 SASI_Rn01_00041684 predicted 652
6 SASI_Rn01_00041685 predicted 654
7 SASI_Rn01_00041686 predicted 407
8 SASI_Rn01_00041687 predicted 392
9 SASI_Rn01_00041689 predicted 126
10 SASI_Rn02_00260113 predicted 213
11 SASI_Rn01_00041688 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013230
VALIDATED
CD24 MISSION shRNA Bacterial Glycerol Stock
CD24 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-163s21c1
Sequence:CCGGTGCTCCTACCCACGCAGATTTCTCGAGAAATCTGCGTGGGTAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-333s21c1
Sequence:CCGGCTTCTGCATCTCTACTCTTAACTCGAGTTAAGAGTAGAGATGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013230.2-857s21c1
Sequence:CCGGACTAATTTAATGCCGATATACCTCGAGGTATATCGGCATTAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-296s21c1
Sequence:CCGGGCAGTCAACAGCCAGTCTCTTCTCGAGAAGAGACTGGCTGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-198s21c1
Sequence:CCGGACAACTGGAACTTCAAGTAACCTCGAGGTTACTTGAAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-117s1c1
Sequence:CCGGCCCACGCAGATTTATTCCAGTCTCGAGACTGGAATAAATCTGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-278s1c1
Sequence:CCGGTCTTCTGCATCTCTACTCTTACTCGAGTAAGAGTAGAGATGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-203s1c1
Sequence:CCGGTCCAACTAATGCCACCACCAACTCGAGTTGGTGGTGGCATTAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-173s1c1
Sequence:CCGGGAGTACTTCCAACTCTGGGTTCTCGAGAACCCAGAGTTGGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-121s1c1
Sequence:CCGGCGCAGATTTATTCCAGTGAAACTCGAGTTTCACTGGAATAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013230
VALIDATED
CD24 MISSION shRNA shRNA Plasmid DNA
CD24 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-163s21c1
Sequence:CCGGTGCTCCTACCCACGCAGATTTCTCGAGAAATCTGCGTGGGTAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-333s21c1
Sequence:CCGGCTTCTGCATCTCTACTCTTAACTCGAGTTAAGAGTAGAGATGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013230.2-857s21c1
Sequence:CCGGACTAATTTAATGCCGATATACCTCGAGGTATATCGGCATTAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-296s21c1
Sequence:CCGGGCAGTCAACAGCCAGTCTCTTCTCGAGAAGAGACTGGCTGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-198s21c1
Sequence:CCGGACAACTGGAACTTCAAGTAACCTCGAGGTTACTTGAAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-117s1c1
Sequence:CCGGCCCACGCAGATTTATTCCAGTCTCGAGACTGGAATAAATCTGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-278s1c1
Sequence:CCGGTCTTCTGCATCTCTACTCTTACTCGAGTAAGAGTAGAGATGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-203s1c1
Sequence:CCGGTCCAACTAATGCCACCACCAACTCGAGTTGGTGGTGGCATTAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-173s1c1
Sequence:CCGGGAGTACTTCCAACTCTGGGTTCTCGAGAACCCAGAGTTGGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-121s1c1
Sequence:CCGGCGCAGATTTATTCCAGTGAAACTCGAGTTTCACTGGAATAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013230
VALIDATED
CD24 MISSION shRNA Lentiviral Transduction Particles
CD24 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-163s21c1
Sequence:CCGGTGCTCCTACCCACGCAGATTTCTCGAGAAATCTGCGTGGGTAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-333s21c1
Sequence:CCGGCTTCTGCATCTCTACTCTTAACTCGAGTTAAGAGTAGAGATGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013230.2-857s21c1
Sequence:CCGGACTAATTTAATGCCGATATACCTCGAGGTATATCGGCATTAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-296s21c1
Sequence:CCGGGCAGTCAACAGCCAGTCTCTTCTCGAGAAGAGACTGGCTGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013230.2-198s21c1
Sequence:CCGGACAACTGGAACTTCAAGTAACCTCGAGGTTACTTGAAGTTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-117s1c1
Sequence:CCGGCCCACGCAGATTTATTCCAGTCTCGAGACTGGAATAAATCTGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-278s1c1
Sequence:CCGGTCTTCTGCATCTCTACTCTTACTCGAGTAAGAGTAGAGATGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-203s1c1
Sequence:CCGGTCCAACTAATGCCACCACCAACTCGAGTTGGTGGTGGCATTAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-173s1c1
Sequence:CCGGGAGTACTTCCAACTCTGGGTTCTCGAGAACCCAGAGTTGGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013230.1-121s1c1
Sequence:CCGGCGCAGATTTATTCCAGTGAAACTCGAGTTTCACTGGAATAAATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks