EMAIL THIS PAGE TO A FRIEND

CD274

CD274 molecule

140 Gene Product Result for
Synonyms: B7-H B7H1 PD-L1 PDCD1L1 PDCD1LG1 PDL1
Gene ID:
Mouse(60533) CD274 antigen
Rat(499342) CD274 molecule
chicken(427224) CD274 molecule
cow(533834) CD274 molecule
dog(484186) CD274 molecule
sheep(101115003) CD274 molecule
naked mole-rat(101719302) CD274 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301882 Anti-CD274 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2900365 Anti-CD274 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2500216 Anti-CD274/PD-L1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
PRS4059 Anti-PDL-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046161 MISSION® esiRNA esiRNA targeting mouse Cd274 (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF404 Anti-CD274 (PD-L1) Antibody (mouse), PE, clone 10F-9G2 100 µg, This rat monoclonal antibody Anti-CD274 (PD-L1) (mouse), PE & clone 10F-9G2 validated for use in Flow Cytometry for the detection of CD274 (PD-L1). pricing
MABF555 Anti-CD274 (PD-L1) Antibody (mouse), PE, clone 10F-9G2 25 µg, This rat monoclonal antibody Anti-CD274 (PD-L1) (mouse), PE & clone 10F-9G2 validated for use in Flow Cytometry for the detection of CD274 (PD-L1). pricing
MABF405 Anti-CD274 (PD-L1, B7-H1) Antibody (mouse), clone 10F.9G2 100 µg, This Rat Monoclonal Antibody Anti-CD274 (PD-L1, B7-H1) (mouse), clone 10F.9G2, Cat. No. MABF405 is validated for use in Flow Cytometry for the detection of CD274 (PD-L1, B7-H1). pricing
ABF133 Anti-PD-L1 Antibody/CD274 100 µg, Anti-PD-L1 Antibody/CD274 is an antibody against PD-L1/CD274 for use in western blotting & flow cytometry. pricing
MABC991 Anti-PD-L1 Antibody, clone 10F.9G2 100 μg, Detect PD-L1 using this rat monoclonal Anti-PD-L1 Antibody, clone 10F.9G2, Cat. No. MABC991. It has been tested in Flow Cytometry, Function Induction, Immunohistochemistry, and Inhibition studies. pricing
MABC980 Anti-PD-L1 Antibody, clone 29E.2A3.C6, Azide Free 100 μg, Anti-PD-L1 Antibody, clone 29E.2A3.C6, Azide Free is an antibody against PD-L1 for use in Immunohistochemistry (Paraffin), Flow Cytometry, Neutralizing, Immunocytochemistry. pricing
ABC324 Anti-PDL-1 Antibody 100 µg, Anti-PDL-1 Antibody is a highly specific rabbit polyclonal antibody, that targets Programmed cell death 1 ligand 1 & has been tested in western blotting, IHC (Paraffin) & Immunofluorescence. pricing
MABC290 Anti-PDL-1/CD274 Antibody, clone 3F2.1 100 µg, Anti-PDL-1/CD274 Antibody, clone 3F2.1 is an antibody against PDL-1/CD274 for use in western blotting & IHC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014143 Rosetta Predictions human pricing
XM_001079572 Rosetta Predictions rat pricing
XM_574652 Rosetta Predictions rat pricing
NM_021893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010201 predicted 206
2 SASI_Hs01_00010202 predicted 923
3 SASI_Hs01_00010203 predicted 223
4 SASI_Hs01_00010204 predicted 223
5 SASI_Hs01_00010205 predicted 346
6 SASI_Hs01_00010206 predicted 704
7 SASI_Hs02_00345135 predicted 535
8 SASI_Hs02_00345136 predicted 281
9 SASI_Hs01_00010208 predicted 712
10 SASI_Hs02_00345137 predicted 879
11 SASI_Hs01_00010207 predicted 229
12 SASI_Hs01_00010209 predicted 781
13 SASI_Hs01_00010210 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364710 predicted 372
2 SASI_Rn02_00364711 predicted 484
3 SASI_Rn02_00364712 predicted 584
4 SASI_Rn02_00364713 predicted 810
5 SASI_Rn02_00364714 predicted 465
6 SASI_Rn02_00364715 predicted 837
7 SASI_Rn02_00364716 predicted 384
8 SASI_Rn02_00364717 predicted 576
9 SASI_Rn02_00364718 predicted 368
10 SASI_Rn02_00364719 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402330 predicted 370
2 SASI_Rn02_00402331 predicted 483
3 SASI_Rn02_00402332 predicted 584
4 SASI_Rn02_00402333 predicted 815
5 SASI_Rn02_00402334 predicted 467
6 SASI_Rn02_00402335 predicted 836
7 SASI_Rn02_00402336 predicted 378
8 SASI_Rn02_00402337 predicted 579
9 SASI_Rn02_00402338 predicted 365
10 SASI_Rn02_00402339 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062675 predicted 1109
2 SASI_Mm01_00062676 predicted 1014
3 SASI_Mm02_00326460 predicted 499
4 SASI_Mm01_00062677 predicted 438
5 SASI_Mm01_00062679 predicted 1040
6 SASI_Mm01_00062680 predicted 276
7 SASI_Mm01_00062681 predicted 240
8 SASI_Mm01_00062682 predicted 215
9 SASI_Mm01_00062683 predicted 882
10 SASI_Mm01_00062684 predicted 1097
11 SASI_Mm01_00062678 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014143
VALIDATED
CD274 MISSION shRNA Bacterial Glycerol Stock
CD274 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014143.2-206s1c1
Sequence:CCGGGCACTAATTGTCTATTGGGAACTCGAGTTCCCAATAGACAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-425s1c1
Sequence:CCGGCGAATTACTGTGAAAGTCAATCTCGAGATTGACTTTCACAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-128s1c1
Sequence:CCGGGACCTATATGTGGTAGAGTATCTCGAGATACTCTACCACATATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-815s1c1
Sequence:CCGGCTGACATTCATCTTCCGTTTACTCGAGTAAACGGAAGATGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-158s21c1
Sequence:CCGGATGACAATTGAATGCAAATTCCTCGAGGAATTTGCATTCAATTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014143.2-1029s21c1
Sequence:CCGGGCAGGCAATGTGGGACTTAAACTCGAGTTTAAGTCCCACATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-90s21c1
Sequence:CCGGGGCATTTGCTGAACGCATTTACTCGAGTAAATGCGTTCAGCAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-228s21c1
Sequence:CCGGTGGAGGATAAGAACATTATTCCTCGAGGAATAATGTTCTTATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014143
VALIDATED
CD274 MISSION shRNA shRNA Plasmid DNA
CD274 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014143.2-206s1c1
Sequence:CCGGGCACTAATTGTCTATTGGGAACTCGAGTTCCCAATAGACAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-425s1c1
Sequence:CCGGCGAATTACTGTGAAAGTCAATCTCGAGATTGACTTTCACAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-128s1c1
Sequence:CCGGGACCTATATGTGGTAGAGTATCTCGAGATACTCTACCACATATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-815s1c1
Sequence:CCGGCTGACATTCATCTTCCGTTTACTCGAGTAAACGGAAGATGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-158s21c1
Sequence:CCGGATGACAATTGAATGCAAATTCCTCGAGGAATTTGCATTCAATTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014143.2-1029s21c1
Sequence:CCGGGCAGGCAATGTGGGACTTAAACTCGAGTTTAAGTCCCACATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-90s21c1
Sequence:CCGGGGCATTTGCTGAACGCATTTACTCGAGTAAATGCGTTCAGCAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-228s21c1
Sequence:CCGGTGGAGGATAAGAACATTATTCCTCGAGGAATAATGTTCTTATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014143
VALIDATED
CD274 MISSION shRNA Lentiviral Transduction Particles
CD274 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014143.2-206s1c1
Sequence:CCGGGCACTAATTGTCTATTGGGAACTCGAGTTCCCAATAGACAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-425s1c1
Sequence:CCGGCGAATTACTGTGAAAGTCAATCTCGAGATTGACTTTCACAGTAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-128s1c1
Sequence:CCGGGACCTATATGTGGTAGAGTATCTCGAGATACTCTACCACATATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014143.2-815s1c1
Sequence:CCGGCTGACATTCATCTTCCGTTTACTCGAGTAAACGGAAGATGAATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-158s21c1
Sequence:CCGGATGACAATTGAATGCAAATTCCTCGAGGAATTTGCATTCAATTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014143.2-1029s21c1
Sequence:CCGGGCAGGCAATGTGGGACTTAAACTCGAGTTTAAGTCCCACATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-90s21c1
Sequence:CCGGGGCATTTGCTGAACGCATTTACTCGAGTAAATGCGTTCAGCAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014143.2-228s21c1
Sequence:CCGGTGGAGGATAAGAACATTATTCCTCGAGGAATAATGTTCTTATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021893
VALIDATED
CD274 MISSION shRNA Bacterial Glycerol Stock
CD274 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-884s1c1
Sequence:CCGGGCGTTGAAGATACAAGCTCAACTCGAGTTGAGCTTGTATCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-502s1c1
Sequence:CCGGGCCACTTCTGAGCATGAACTACTCGAGTAGTTCATGCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-909s1c1
Sequence:CCGGCCGAAATGATACACAATTCGACTCGAGTCGAATTGTGTATCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-120s1c1
Sequence:CCGGGTTTACTATCACGGCTCCAAACTCGAGTTTGGAGCCGTGATAGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-392s1c1
Sequence:CCGGCAGGCGTTTACTGCTGCATAACTCGAGTTATGCAGCAGTAAACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021893
VALIDATED
CD274 MISSION shRNA shRNA Plasmid DNA
CD274 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-884s1c1
Sequence:CCGGGCGTTGAAGATACAAGCTCAACTCGAGTTGAGCTTGTATCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-502s1c1
Sequence:CCGGGCCACTTCTGAGCATGAACTACTCGAGTAGTTCATGCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-909s1c1
Sequence:CCGGCCGAAATGATACACAATTCGACTCGAGTCGAATTGTGTATCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-120s1c1
Sequence:CCGGGTTTACTATCACGGCTCCAAACTCGAGTTTGGAGCCGTGATAGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-392s1c1
Sequence:CCGGCAGGCGTTTACTGCTGCATAACTCGAGTTATGCAGCAGTAAACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021893
VALIDATED
CD274 MISSION shRNA Lentiviral Transduction Particles
CD274 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-884s1c1
Sequence:CCGGGCGTTGAAGATACAAGCTCAACTCGAGTTGAGCTTGTATCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-502s1c1
Sequence:CCGGGCCACTTCTGAGCATGAACTACTCGAGTAGTTCATGCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021893.2-909s1c1
Sequence:CCGGCCGAAATGATACACAATTCGACTCGAGTCGAATTGTGTATCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-120s1c1
Sequence:CCGGGTTTACTATCACGGCTCCAAACTCGAGTTTGGAGCCGTGATAGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021893.2-392s1c1
Sequence:CCGGCAGGCGTTTACTGCTGCATAACTCGAGTTATGCAGCAGTAAACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks