EMAIL THIS PAGE TO A FRIEND

CD276

CD276 molecule

97 Gene Product Result for
Synonyms: 4Ig-B7-H3 B7-H3 B7H3 B7RP-2
Gene ID:
Human(80381) Summary: The protein encoded by this gene belongs to the immunoglobulin superfamily, and thought to participate in the regulation of T-cell-mediated immune response. Studies show that while the transcript of this gene is ubiquitously expressed in normal tissues and solid tumors, the protein is preferentially expressed only in tumor tissues. Additionally, it was observed that the 3' UTR of this transcript contains a target site for miR29 microRNA, and there is an inverse correlation between the expression of this protein and miR29 levels, suggesting regulation of expression of this gene product by miR29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(102657) CD276 antigen
Rat(315716) Cd276 molecule
naked mole-rat(101706898) CD276 molecule
sheep(101111370) CD276 molecule
Zebrafish(791140) CD276 molecule
dog(487638) CD276 molecule
cow(508656) CD276 molecule
domestic cat(101087927) CD276 molecule
chicken(415315) CD276 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1282 Human B7-H3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024736 Rosetta Predictions human pricing
NM_025240 Rosetta Predictions human pricing
NM_182824 Rosetta Predictions rat pricing
NM_133983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181952 predicted 2139
2 SASI_Hs01_00181953 predicted 1823
3 SASI_Hs01_00181954 predicted 2204
4 SASI_Hs01_00181955 predicted 1993
5 SASI_Hs01_00181956 predicted 1874
6 SASI_Hs01_00181957 predicted 2315
7 SASI_Hs01_00181958 predicted 2098
8 SASI_Hs01_00181959 predicted 2000
9 SASI_Hs01_00181960 predicted 1684
10 SASI_Hs02_00307245 predicted 1684
11 SASI_Hs01_00181961 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087688 predicted 1482
2 SASI_Hs01_00087689 predicted 1166
3 SASI_Hs01_00087690 predicted 1549
4 SASI_Hs01_00087691 predicted 1341
5 SASI_Hs01_00087692 predicted 1216
6 SASI_Hs01_00087693 predicted 1667
7 SASI_Hs01_00087694 predicted 1440
8 SASI_Hs01_00087695 predicted 1345
9 SASI_Hs01_00087696 predicted 1022
10 SASI_Hs02_00358066 predicted 1033
11 SASI_Hs01_00087697 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049506 predicted 956
2 SASI_Rn01_00049507 predicted 1305
3 SASI_Rn01_00049508 predicted 1047
4 SASI_Rn01_00049509 predicted 1462
5 SASI_Rn01_00049510 predicted 1172
6 SASI_Rn01_00049511 predicted 1289
7 SASI_Rn02_00269854 predicted 1526
8 SASI_Rn01_00049513 predicted 422
9 SASI_Rn01_00049514 predicted 1238
10 SASI_Rn01_00049515 predicted 1476
11 SASI_Rn01_00049512 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178445 predicted 681
2 SASI_Mm01_00178446 predicted 1232
3 SASI_Mm01_00178447 predicted 1121
4 SASI_Mm01_00178448 predicted 582
5 SASI_Mm01_00178449 predicted 1133
6 SASI_Mm01_00178450 predicted 565
7 SASI_Mm01_00178451 predicted 336
8 SASI_Mm01_00178452 predicted 755
9 SASI_Mm01_00178453 predicted 1478
10 SASI_Mm02_00339112 predicted 890
11 SASI_Mm01_00178454 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024736
VALIDATED
CD276 MISSION shRNA Bacterial Glycerol Stock
CD276 molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1112s21c1
Sequence:CCGGTGGTGCACAGTTTCACCGAAGCTCGAGCTTCGGTGAAACTGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1476s21c1
Sequence:CCGGCAACGAGCAGGGCTTGTTTGACTCGAGTCAAACAAGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1696s21c1
Sequence:CCGGTGCTGGAGAAAGATCAAACAGCTCGAGCTGTTTGATCTTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-833s1c1
Sequence:CCGGGCTTGTTTGATGTGCACAGCACTCGAGTGCTGTGCACATCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-1790s1c1
Sequence:CCGGCTCTGAAACACTCTGACAGCACTCGAGTGCTGTCAGAGTGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001024736.1-1809s1c1
Sequence:CCGGCAAAGAAGATGATGGACAAGACTCGAGTCTTGTCCATCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024736.1-1792s1c1
Sequence:CCGGCTGAAACACTCTGACAGCAAACTCGAGTTTGCTGTCAGAGTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024736
VALIDATED
CD276 MISSION shRNA shRNA Plasmid DNA
CD276 molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1112s21c1
Sequence:CCGGTGGTGCACAGTTTCACCGAAGCTCGAGCTTCGGTGAAACTGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1476s21c1
Sequence:CCGGCAACGAGCAGGGCTTGTTTGACTCGAGTCAAACAAGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1696s21c1
Sequence:CCGGTGCTGGAGAAAGATCAAACAGCTCGAGCTGTTTGATCTTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-833s1c1
Sequence:CCGGGCTTGTTTGATGTGCACAGCACTCGAGTGCTGTGCACATCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-1790s1c1
Sequence:CCGGCTCTGAAACACTCTGACAGCACTCGAGTGCTGTCAGAGTGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001024736.1-1809s1c1
Sequence:CCGGCAAAGAAGATGATGGACAAGACTCGAGTCTTGTCCATCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024736.1-1792s1c1
Sequence:CCGGCTGAAACACTCTGACAGCAAACTCGAGTTTGCTGTCAGAGTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024736
VALIDATED
CD276 MISSION shRNA Lentiviral Transduction Particles
CD276 molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1112s21c1
Sequence:CCGGTGGTGCACAGTTTCACCGAAGCTCGAGCTTCGGTGAAACTGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1476s21c1
Sequence:CCGGCAACGAGCAGGGCTTGTTTGACTCGAGTCAAACAAGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024736.1-1696s21c1
Sequence:CCGGTGCTGGAGAAAGATCAAACAGCTCGAGCTGTTTGATCTTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-833s1c1
Sequence:CCGGGCTTGTTTGATGTGCACAGCACTCGAGTGCTGTGCACATCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001024736.1-1790s1c1
Sequence:CCGGCTCTGAAACACTCTGACAGCACTCGAGTGCTGTCAGAGTGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001024736.1-1809s1c1
Sequence:CCGGCAAAGAAGATGATGGACAAGACTCGAGTCTTGTCCATCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024736.1-1792s1c1
Sequence:CCGGCTGAAACACTCTGACAGCAAACTCGAGTTTGCTGTCAGAGTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133983
VALIDATED
CD276 MISSION shRNA Bacterial Glycerol Stock
CD276 molecule
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-975s21c1
Sequence:CCGGTGTCTGTCTTGTGGTACTACTCTCGAGAGTAGTACCACAAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-500s21c1
Sequence:CCGGACCTGTTGGTGCAAGGCAATGCTCGAGCATTGCCTTGCACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-2304s21c1
Sequence:CCGGTCGACTTCCTGCCCAACTATTCTCGAGAATAGTTGGGCAGGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-575s21c1
Sequence:CCGGTTGTGAGCATCCAGGACTTTGCTCGAGCAAAGTCCTGGATGCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-1141s21c1
Sequence:CCGGGGACAAGAAATTGCTTGATTGCTCGAGCAATCAAGCAATTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2191s1c1
Sequence:CCGGCCAACTATTCTATCCTGACTACTCGAGTAGTCAGGATAGAATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1136s1c1
Sequence:CCGGGATGACGGACAAGAAATTGCTCTCGAGAGCAATTTCTTGTCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2942s1c1
Sequence:CCGGGCTGGGATATATACCTGGCTTCTCGAGAAGCCAGGTATATATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-3032s1c1
Sequence:CCGGCCTGAGAACCTGAGGATAATTCTCGAGAATTATCCTCAGGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1129s1c1
Sequence:CCGGCAAAGAAGATGACGGACAAGACTCGAGTCTTGTCCGTCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1085s1c1
Sequence:CCGGGAAGGATCCAAGACAGCTCTACTCGAGTAGAGCTGTCTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133983
VALIDATED
CD276 MISSION shRNA shRNA Plasmid DNA
CD276 molecule
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-975s21c1
Sequence:CCGGTGTCTGTCTTGTGGTACTACTCTCGAGAGTAGTACCACAAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-500s21c1
Sequence:CCGGACCTGTTGGTGCAAGGCAATGCTCGAGCATTGCCTTGCACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-2304s21c1
Sequence:CCGGTCGACTTCCTGCCCAACTATTCTCGAGAATAGTTGGGCAGGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-575s21c1
Sequence:CCGGTTGTGAGCATCCAGGACTTTGCTCGAGCAAAGTCCTGGATGCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-1141s21c1
Sequence:CCGGGGACAAGAAATTGCTTGATTGCTCGAGCAATCAAGCAATTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2191s1c1
Sequence:CCGGCCAACTATTCTATCCTGACTACTCGAGTAGTCAGGATAGAATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1136s1c1
Sequence:CCGGGATGACGGACAAGAAATTGCTCTCGAGAGCAATTTCTTGTCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2942s1c1
Sequence:CCGGGCTGGGATATATACCTGGCTTCTCGAGAAGCCAGGTATATATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-3032s1c1
Sequence:CCGGCCTGAGAACCTGAGGATAATTCTCGAGAATTATCCTCAGGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1129s1c1
Sequence:CCGGCAAAGAAGATGACGGACAAGACTCGAGTCTTGTCCGTCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1085s1c1
Sequence:CCGGGAAGGATCCAAGACAGCTCTACTCGAGTAGAGCTGTCTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133983
VALIDATED
CD276 MISSION shRNA Lentiviral Transduction Particles
CD276 molecule
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-975s21c1
Sequence:CCGGTGTCTGTCTTGTGGTACTACTCTCGAGAGTAGTACCACAAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-500s21c1
Sequence:CCGGACCTGTTGGTGCAAGGCAATGCTCGAGCATTGCCTTGCACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-2304s21c1
Sequence:CCGGTCGACTTCCTGCCCAACTATTCTCGAGAATAGTTGGGCAGGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-575s21c1
Sequence:CCGGTTGTGAGCATCCAGGACTTTGCTCGAGCAAAGTCCTGGATGCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133983.4-1141s21c1
Sequence:CCGGGGACAAGAAATTGCTTGATTGCTCGAGCAATCAAGCAATTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2191s1c1
Sequence:CCGGCCAACTATTCTATCCTGACTACTCGAGTAGTCAGGATAGAATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1136s1c1
Sequence:CCGGGATGACGGACAAGAAATTGCTCTCGAGAGCAATTTCTTGTCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-2942s1c1
Sequence:CCGGGCTGGGATATATACCTGGCTTCTCGAGAAGCCAGGTATATATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133983.2-3032s1c1
Sequence:CCGGCCTGAGAACCTGAGGATAATTCTCGAGAATTATCCTCAGGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1129s1c1
Sequence:CCGGCAAAGAAGATGACGGACAAGACTCGAGTCTTGTCCGTCATCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133983.2-1085s1c1
Sequence:CCGGGAAGGATCCAAGACAGCTCTACTCGAGTAGAGCTGTCTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks