EMAIL THIS PAGE TO A FRIEND

CD27

CD27 molecule

101 Gene Product Result for
Synonyms: S152 S152. LPFS2 T14 TNFRSF7 Tp55
UniProtKB ID: P26842, B2RDZ0
Gene ID:
Human(939) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]
Mouse(21940) CD27 antigen
Rat(500318) CD27 molecule
cow(512514) CD27 molecule
dog(611674) CD27 molecule
domestic cat(101091633) CD27 molecule
sheep(101114260) CD27 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_284241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001242 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027401 MISSION® esiRNA esiRNA human CD27 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
04-1475-I Anti-CD27 Antibody, clone RM27-3E5 100 µL, This rat monoclonal Anti-CD27 Antibody, clone RM27-3E5, Cat. No. 04-1475-I is validated for use in Flow Cytometry and Neutralization applications for the analysis of CD27. pricing
MABF399 Anti-CD27 Antibody (human), APC, clone O323 100 tests, This Mouse Monoclonal Antibody Anti-CD27 (human), APC, clone O323, Cat. No. MABF399 is validated for use in FC for the detection of CD27. pricing
MABF551 Anti-CD27 Antibody (human), APC, clone O323 25 tests, This mouse monoclonal antibody Anti-CD27 (human), APC & clone O323 validated for use in Flow Cytometry for the detection of CD27. pricing
MABF400 Anti-CD27 Antibody (human), APC-Cy7, clone O323 100 tests, This Mouse Monoclonal Antibody Anti-CD27 (human), APC-Cy7, clone O323, Cat. No. MABF400 is validated for use in FC for the detection of CD27. pricing
MABF552 Anti-CD27 Antibody (human), APC-Cy7, clone O323 25 tests, This mouse monoclonal antibody Anti-CD27 (human), APC-Cy7 & clone O323 validated for use in Flow Cytometry for the detection of CD27. pricing
MABF403 Anti-CD27 Antibody (human), clone O323 100 µg, This Mouse Monoclonal Antibody Anti-CD27 (human), clone O323, Cat. No. MABF403 is validated for use in Flow Cytometry for the detection of CD27. pricing
MABF401 Anti-CD27 Antibody (human), PE, clone O323 100 tests, This Mouse Monoclonal Antibody Anti-CD27 (human), PE, clone O323, Cat. No. MABF401 is validated for use in FC for the detection of CD27. pricing
MABF553 Anti-CD27 Antibody (human), PE, clone O323 25 tests, This mouse monoclonal antibody Anti-CD27 (human), PE & clone O323 validated for use in Flow Cytometry for the detection of CD27. pricing
MABF402 Anti-CD27 Antibody (human), PE-Cy7, clone O323 100 tests, This mouse monoclonal antibody Anti-CD27 (human), PE-Cy7 & clone O323 validated for use in Flow Cytometry for the detection of CD27. pricing
MABF554 Anti-CD27 Antibody (human), PE-Cy7, clone O323 25 tests, This mouse monoclonal antibody Anti-CD27 (human), PE-Cy7 & clone O323 validated for use in Flow Cytometry for the detection of CD27. pricing
MABF760 Anti-CD27, clone EPR8569, Rabbit Monoclonal Antibody 100 µL, This Anti-CD27 antibody is validated for use in WB, IH for the detection of CD27. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001242 Rosetta Predictions human pricing
NM_001024335 Rosetta Predictions rat pricing
NM_001033126 Rosetta Predictions mouse pricing
NM_001042564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191954 predicted 638
2 SASI_Hs01_00191955 predicted 542
3 SASI_Hs01_00191956 predicted 1057
4 SASI_Hs01_00191957 predicted 550
5 SASI_Hs01_00191958 predicted 1055
6 SASI_Hs01_00191959 predicted 482
7 SASI_Hs01_00191962 predicted 887
8 SASI_Hs01_00191963 predicted 465
9 SASI_Hs02_00331418 predicted 359
10 SASI_Hs02_00331419 predicted 557
11 SASI_Hs01_00191960 predicted 836
12 SASI_Hs01_00191961 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114579 predicted 428
2 SASI_Rn01_00114580 predicted 407
3 SASI_Rn01_00114581 predicted 705
4 SASI_Rn01_00114582 predicted 677
5 SASI_Rn01_00114583 predicted 628
6 SASI_Rn01_00114584 predicted 646
7 SASI_Rn01_00114585 predicted 532
8 SASI_Rn01_00114587 predicted 852
9 SASI_Rn01_00114588 predicted 657
10 SASI_Rn02_00202558 predicted 935
11 SASI_Rn01_00114586 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288195 predicted 1082
2 SASI_Mm01_00057937 predicted 779
3 SASI_Mm01_00057939 predicted 973
4 SASI_Mm02_00288196 predicted 1077
5 SASI_Mm02_00288197 predicted 1081
6 SASI_Mm02_00288198 predicted 965
7 SASI_Mm02_00288199 predicted 964
8 SASI_Mm02_00288200 predicted 967
9 SASI_Mm02_00288201 predicted 1070
10 SASI_Mm02_00288202 predicted 1008
11 SASI_Mm01_00057933 predicted 714
12 SASI_Mm01_00057934 predicted 257
13 SASI_Mm01_00057935 predicted 410
14 SASI_Mm01_00057936 predicted 645
15 SASI_Mm01_00057938 predicted 687
16 SASI_Mm01_00057940 predicted 294
17 SASI_Mm01_00057941 predicted 374
18 SASI_Mm01_00057942 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290615 predicted 769
2 SASI_Mm02_00290616 predicted 470
3 SASI_Mm02_00290617 predicted 666
4 SASI_Mm02_00290618 predicted 764
5 SASI_Mm02_00290619 predicted 771
6 SASI_Mm02_00290620 predicted 658
7 SASI_Mm02_00290621 predicted 659
8 SASI_Mm02_00290622 predicted 647
9 SASI_Mm02_00290623 predicted 762
10 SASI_Mm02_00290624 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284241
CD27 MISSION shRNA Bacterial Glycerol Stock
CD27 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-547s1c1
Sequence:CCGGGCAATCTTGTTCTTCCATCAACTCGAGTTGATGGAAGAACAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-313s1c1
Sequence:CCGGGCTCAGTGTGATCCCTGTATACTCGAGTATACAGGGATCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-267s1c1
Sequence:CCGGGCCAGGTACATTCTTTGTGAACTCGAGTTCACAAAGAATGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-387s1c1
Sequence:CCGGCAGGCATTGTAACTCTGAGAACTCGAGTTCTCAGAGTTACAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-432s1c1
Sequence:CCGGGCTTCCCAACTCGACTGTCTACTCGAGTAGACAGTCGAGTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284241
CD27 MISSION shRNA shRNA Plasmid DNA
CD27 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-547s1c1
Sequence:CCGGGCAATCTTGTTCTTCCATCAACTCGAGTTGATGGAAGAACAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-313s1c1
Sequence:CCGGGCTCAGTGTGATCCCTGTATACTCGAGTATACAGGGATCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-267s1c1
Sequence:CCGGGCCAGGTACATTCTTTGTGAACTCGAGTTCACAAAGAATGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-387s1c1
Sequence:CCGGCAGGCATTGTAACTCTGAGAACTCGAGTTCTCAGAGTTACAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-432s1c1
Sequence:CCGGGCTTCCCAACTCGACTGTCTACTCGAGTAGACAGTCGAGTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284241
CD27 MISSION shRNA Lentiviral Transduction Particles
CD27 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-547s1c1
Sequence:CCGGGCAATCTTGTTCTTCCATCAACTCGAGTTGATGGAAGAACAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-313s1c1
Sequence:CCGGGCTCAGTGTGATCCCTGTATACTCGAGTATACAGGGATCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-267s1c1
Sequence:CCGGGCCAGGTACATTCTTTGTGAACTCGAGTTCACAAAGAATGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-387s1c1
Sequence:CCGGCAGGCATTGTAACTCTGAGAACTCGAGTTCTCAGAGTTACAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284241.3-432s1c1
Sequence:CCGGGCTTCCCAACTCGACTGTCTACTCGAGTAGACAGTCGAGTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001242
CD27 MISSION shRNA Bacterial Glycerol Stock
CD27 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-452s1c1
Sequence:CCGGGCACTGTAACTCTGGTCTTCTCTCGAGAGAAGACCAGAGTTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-629s1c1
Sequence:CCGGCTTACCTTATGTCAGTGAGATCTCGAGATCTCACTGACATAAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-316s1c1
Sequence:CCGGGCCAGATGTGTGAGCCAGGAACTCGAGTTCCTGGCTCACACATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-622s1c1
Sequence:CCGGCCACCCACTTACCTTATGTCACTCGAGTGACATAAGGTAAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001242.x-1250s1c1
Sequence:CCGGCGAAAGACCCACATGCTACAACTCGAGTTGTAGCATGTGGGTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001242
CD27 MISSION shRNA shRNA Plasmid DNA
CD27 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-452s1c1
Sequence:CCGGGCACTGTAACTCTGGTCTTCTCTCGAGAGAAGACCAGAGTTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-629s1c1
Sequence:CCGGCTTACCTTATGTCAGTGAGATCTCGAGATCTCACTGACATAAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-316s1c1
Sequence:CCGGGCCAGATGTGTGAGCCAGGAACTCGAGTTCCTGGCTCACACATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-622s1c1
Sequence:CCGGCCACCCACTTACCTTATGTCACTCGAGTGACATAAGGTAAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001242.x-1250s1c1
Sequence:CCGGCGAAAGACCCACATGCTACAACTCGAGTTGTAGCATGTGGGTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001242
CD27 MISSION shRNA Lentiviral Transduction Particles
CD27 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-452s1c1
Sequence:CCGGGCACTGTAACTCTGGTCTTCTCTCGAGAGAAGACCAGAGTTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-629s1c1
Sequence:CCGGCTTACCTTATGTCAGTGAGATCTCGAGATCTCACTGACATAAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-316s1c1
Sequence:CCGGGCCAGATGTGTGAGCCAGGAACTCGAGTTCCTGGCTCACACATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001242.x-622s1c1
Sequence:CCGGCCACCCACTTACCTTATGTCACTCGAGTGACATAAGGTAAGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001242.x-1250s1c1
Sequence:CCGGCGAAAGACCCACATGCTACAACTCGAGTTGTAGCATGTGGGTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks