EMAIL THIS PAGE TO A FRIEND

CD28

CD28 molecule

254 Gene Product Result for
Synonyms: Tp44
Gene ID:
Human(940) Summary: The protein encoded by this gene is essential for T-cell proliferation and survival, cytokine production, and T-helper type-2 development. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Mouse(12487) CD28 antigen
Rat(25660) Cd28 molecule
Zebrafish(100004384) CD28 molecule
domestic cat(493802) CD28 molecule
cow(281050) CD28 molecule
Horse(100067829) CD28 molecule
dog(403646) CD28 molecule
chicken(396249) CD28 molecule
sheep(443480) CD28 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501381 Anti-Cd28 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig
ELISA, western blot pricing
SAB2501674 Anti-CD28 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405583 Anti-CD28 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA070003 Anti-CD28 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
C7831 Anti-CD28 antibody, Mouse monoclonal clone CD28.2, purified from hybridoma cell culture rhesus monkey, human
flow cytometry, immunocytochemistry, immunohistochemistry pricing
SAB4504133 Anti-phospho-CD28 (pTyr218) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4700135 Monoclonal Anti-CD28 antibody produced in mouse low endotoxin, clone CD28.2, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700739 Monoclonal Anti-CD28 antibody produced in mouse clone JJ319, purified immunoglobulin, buffered aqueous solution rat
flow cytometry, FUNC, immunoprecipitation pricing
SAB4700751 Monoclonal Anti-CD28 antibody produced in mouse clone CD28.2, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry, FUNC, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700551 Monoclonal Anti-Cd28 low endotoxin antibody produced in hamster clone 37.51, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700136 Monoclonal Anti-CD28-APC antibody produced in mouse clone CD28.2, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700138 Monoclonal Anti-CD28-FITC antibody produced in mouse clone CD28.2, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700139 Monoclonal Anti-CD28-PE antibody produced in mouse clone CD28.2, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1327 Human CD28 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087121 MISSION® esiRNA esiRNA human CD28 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
CBL517 Anti-CD28 Antibody, clone 15E8 100 µg, This Anti-CD28 Antibody, clone 15E8 is validated for use in FC, FUNC for the detection of CD28. pricing
MABF408 Anti-CD28 Antibody (human), APC, clone CD28.2 100 tests, This mouse monoclonal antibody Anti-CD28 (human), APC & clone CD28.2 validated for use in IP;IHC;Flow Cytometry for the detection of CD28. pricing
MABF557 Anti-CD28 Antibody (human), APC, clone CD28.2 25 tests, This mouse monoclonal antibody Anti-CD28 (human), APC & clone CD28.2 validated for use in IP;IHC;Flow Cytometry for the detection of CD28. pricing
MABF411 Anti-CD28 Antibody (human), FITC, clone CD28.2 100 tests, This mouse monoclonal antibody Anti-CD28 (human), FITC, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
MABF560 Anti-CD28 Antibody (human), FITC, clone CD28.2 25 tests, This mouse monoclonal antibody Anti-CD28 (human), FITC, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
MABF409 Anti-CD28 Antibody (human), PE, clone CD28.2 100 tests, This mouse monoclonal antibody Anti-CD28 (human), PE, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
MABF558 Anti-CD28 Antibody (human), PE, clone CD28.2 25 tests, This mouse monoclonal antibody Anti-CD28 (human), PE, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
MABF410 Anti-CD28 Antibody (human), PE-Cy7, clone CD28.2 100 tests, This mouse monoclonal antibody Anti-CD28 (human), PE-Cy7, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
MABF559 Anti-CD28 Antibody (human), PE-Cy7, clone CD28.2 25 tests, This mouse monoclonal antibody Anti-CD28 (human), PE-Cy7, clone CD28.2 validated for use in IP, IHC & Flow Cytometry for the detection of CD28. pricing
04-963 Anti-CTLA4 (CD152) Antibody, clone 9H10 100 µg, Anti-CTLA4 (CD152) Antibody, clone 9H10 is an antibody against CTLA4 (CD152) for use in WB, FC & IP. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006139 Rosetta Predictions human pricing
NM_013121 Rosetta Predictions rat pricing
NM_007642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156771 predicted 425
2 SASI_Hs01_00156772 predicted 236
3 SASI_Hs01_00156773 predicted 332
4 SASI_Hs01_00156775 predicted 477
5 SASI_Hs01_00156776 predicted 608
6 SASI_Hs01_00156777 predicted 652
7 SASI_Hs01_00156778 predicted 519
8 SASI_Hs01_00156779 predicted 498
9 SASI_Hs02_00340973 predicted 382
10 SASI_Hs02_00340974 predicted 947
11 SASI_Hs01_00156774 predicted 584
12 SASI_Hs01_00156780 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082494 predicted 786
2 SASI_Rn02_00260899 predicted 528
3 SASI_Rn01_00082495 predicted 835
4 SASI_Rn01_00082496 predicted 910
5 SASI_Rn01_00082497 predicted 394
6 SASI_Rn01_00082499 predicted 537
7 SASI_Rn01_00082500 predicted 458
8 SASI_Rn01_00082501 predicted 208
9 SASI_Rn01_00082502 predicted 854
10 SASI_Rn01_00082503 predicted 407
11 SASI_Rn01_00082498 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312123 predicted 208
2 SASI_Mm01_00138101 predicted 476
3 SASI_Mm02_00312124 predicted 215
4 SASI_Mm01_00138106 predicted 1002
5 SASI_Mm01_00138107 predicted 603
6 SASI_Mm01_00138108 predicted 469
7 SASI_Mm01_00138109 predicted 886
8 SASI_Mm01_00138110 predicted 391
9 SASI_Mm02_00312125 predicted 970
10 SASI_Mm02_00312126 predicted 972
11 SASI_Mm01_00138102 predicted 416
12 SASI_Mm01_00138103 predicted 870
13 SASI_Mm01_00138104 predicted 850
14 SASI_Mm01_00138105 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006139
CD28 MISSION shRNA Bacterial Glycerol Stock
CD28 molecule
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-577s1c1
Sequence:CCGGCCTCCTCCTTACCTAGACAATCTCGAGATTGTCTAGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-516s1c1
Sequence:CCGGCCTCCAGAATTTGTATGTTAACTCGAGTTAACATACAAATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-829s1c1
Sequence:CCGGCGCAAGCATTACCAGCCCTATCTCGAGATAGGGCTGGTAATGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-406s1c1
Sequence:CCGGGCTGTGGAAGTCTGTGTTGTACTCGAGTACAACACAGACTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-702s21c1
Sequence:CCGGTGGAGTCCTGGCTTGCTATAGCTCGAGCTATAGCAAGCCAGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-330s21c1
Sequence:CCGGCAACCTTAGCTGCAAGTATTCCTCGAGGAATACTTGCAGCTAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006139
CD28 MISSION shRNA shRNA Plasmid DNA
CD28 molecule
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-577s1c1
Sequence:CCGGCCTCCTCCTTACCTAGACAATCTCGAGATTGTCTAGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-516s1c1
Sequence:CCGGCCTCCAGAATTTGTATGTTAACTCGAGTTAACATACAAATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-829s1c1
Sequence:CCGGCGCAAGCATTACCAGCCCTATCTCGAGATAGGGCTGGTAATGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-406s1c1
Sequence:CCGGGCTGTGGAAGTCTGTGTTGTACTCGAGTACAACACAGACTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-702s21c1
Sequence:CCGGTGGAGTCCTGGCTTGCTATAGCTCGAGCTATAGCAAGCCAGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-330s21c1
Sequence:CCGGCAACCTTAGCTGCAAGTATTCCTCGAGGAATACTTGCAGCTAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006139
CD28 MISSION shRNA Lentiviral Transduction Particles
CD28 molecule
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-577s1c1
Sequence:CCGGCCTCCTCCTTACCTAGACAATCTCGAGATTGTCTAGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-516s1c1
Sequence:CCGGCCTCCAGAATTTGTATGTTAACTCGAGTTAACATACAAATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-829s1c1
Sequence:CCGGCGCAAGCATTACCAGCCCTATCTCGAGATAGGGCTGGTAATGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006139.1-406s1c1
Sequence:CCGGGCTGTGGAAGTCTGTGTTGTACTCGAGTACAACACAGACTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-702s21c1
Sequence:CCGGTGGAGTCCTGGCTTGCTATAGCTCGAGCTATAGCAAGCCAGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006139.2-330s21c1
Sequence:CCGGCAACCTTAGCTGCAAGTATTCCTCGAGGAATACTTGCAGCTAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007642
CD28 MISSION shRNA Bacterial Glycerol Stock
CD28 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-46s1c1
Sequence:CCGGTCTCAGTTCAAGTAACAGAAACTCGAGTTTCTGTTACTTGAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-522s1c1
Sequence:CCGGCTTTGTGTTATCTGGACAAATCTCGAGATTTGTCCAGATAACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007642.2-3763s1c1
Sequence:CCGGGCCACCATTAACCCAAGTTAACTCGAGTTAACTTGGGTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-320s1c1
Sequence:CCGGCGTCAATCACACAGATATTTACTCGAGTAAATATCTGTGTGATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-281s1c1
Sequence:CCGGCGACAACGAAACAGTGACGTTCTCGAGAACGTCACTGTTTCGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007642
CD28 MISSION shRNA shRNA Plasmid DNA
CD28 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-46s1c1
Sequence:CCGGTCTCAGTTCAAGTAACAGAAACTCGAGTTTCTGTTACTTGAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-522s1c1
Sequence:CCGGCTTTGTGTTATCTGGACAAATCTCGAGATTTGTCCAGATAACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007642.2-3763s1c1
Sequence:CCGGGCCACCATTAACCCAAGTTAACTCGAGTTAACTTGGGTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-320s1c1
Sequence:CCGGCGTCAATCACACAGATATTTACTCGAGTAAATATCTGTGTGATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-281s1c1
Sequence:CCGGCGACAACGAAACAGTGACGTTCTCGAGAACGTCACTGTTTCGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007642
CD28 MISSION shRNA Lentiviral Transduction Particles
CD28 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-46s1c1
Sequence:CCGGTCTCAGTTCAAGTAACAGAAACTCGAGTTTCTGTTACTTGAACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-522s1c1
Sequence:CCGGCTTTGTGTTATCTGGACAAATCTCGAGATTTGTCCAGATAACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007642.2-3763s1c1
Sequence:CCGGGCCACCATTAACCCAAGTTAACTCGAGTTAACTTGGGTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-320s1c1
Sequence:CCGGCGTCAATCACACAGATATTTACTCGAGTAAATATCTGTGTGATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007642.2-281s1c1
Sequence:CCGGCGACAACGAAACAGTGACGTTCTCGAGAACGTCACTGTTTCGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks