EMAIL THIS PAGE TO A FRIEND

CD2

CD2 molecule

85 Gene Product Result for
Synonyms: LFA-2 SRBC T11
UniProtKB ID: P06729, Q96TE5
Gene ID:
Human(914) Summary: CD2 is a surface antigen of the human T-lymphocyte lineage that is expressed on all peripheral blood T cells (summarized by Sewell et al., 1986 [PubMed 3490670]
Mouse(12481) CD2 antigen
Rat(497761) Cd2 molecule
chicken(768858) CD2 molecule
cow(497022) CD2 molecule
Horse(100034205) CD2 molecule
domestic cat(493790) CD2 molecule
dog(607448) CD2 molecule
sheep(101106727) CD2 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405575 Anti-CD2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA003883 Anti-CD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1401053 Anti-CD2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
SAB4700032 Monoclonal Anti-CD2 antibody produced in mouse clone MEM-65, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700033 Monoclonal Anti-CD2 antibody produced in mouse clone LT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4100531 Monoclonal Anti-CD2 antibody produced in mouse clone CD2-A479, culture supernatant human
western blot pricing
SAB4700034 Monoclonal Anti-CD2-APC antibody produced in mouse clone LT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700035 Monoclonal Anti-CD2-Biotin antibody produced in mouse clone MEM-65, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700037 Monoclonal Anti-CD2-FITC antibody produced in mouse clone LT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700038 Monoclonal Anti-CD2-PE antibody produced in mouse clone MEM-65, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700039 Monoclonal Anti-CD2-PE antibody produced in mouse clone LT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1324 Human CD2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001767 Rosetta Predictions human pricing
NM_012830 Rosetta Predictions rat pricing
XM_579351 Rosetta Predictions rat pricing
NM_013486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049684 predicted 341
2 SASI_Hs01_00049685 predicted 423
3 SASI_Hs01_00049686 predicted 331
4 SASI_Hs01_00049687 predicted 1299
5 SASI_Hs02_00332506 predicted 588
6 SASI_Hs01_00049688 predicted 486
7 SASI_Hs01_00049689 predicted 1286
8 SASI_Hs01_00049690 predicted 329
9 SASI_Hs02_00332507 predicted 501
10 SASI_Hs01_00049691 predicted 1145
11 SASI_Hs01_00049692 predicted 768
12 SASI_Hs01_00049693 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115674 predicted 447
2 SASI_Rn01_00115675 predicted 720
3 SASI_Rn01_00115676 predicted 360
4 SASI_Rn01_00115677 predicted 458
5 SASI_Rn01_00115678 predicted 611
6 SASI_Rn01_00115679 predicted 597
7 SASI_Rn01_00115680 predicted 507
8 SASI_Rn01_00115681 predicted 330
9 SASI_Rn01_00115682 predicted 206
10 SASI_Rn02_00260283 predicted 384
11 SASI_Rn01_00115683 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147184 predicted 417
2 SASI_Rn01_00147185 predicted 330
3 SASI_Rn01_00147186 predicted 343
4 SASI_Rn01_00147187 predicted 301
5 SASI_Rn01_00147188 predicted 400
6 SASI_Rn01_00147189 predicted 368
7 SASI_Rn01_00147190 predicted 301
8 SASI_Rn01_00147191 predicted 413
9 SASI_Rn01_00147192 predicted 367
10 SASI_Rn01_00147193 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185036 predicted 621
2 SASI_Mm01_00185037 predicted 626
3 SASI_Mm01_00185038 predicted 356
4 SASI_Mm01_00185039 predicted 475
5 SASI_Mm01_00185040 predicted 603
6 SASI_Mm01_00185041 predicted 286
7 SASI_Mm01_00185042 predicted 691
8 SASI_Mm01_00185043 predicted 583
9 SASI_Mm01_00185044 predicted 597
10 SASI_Mm02_00322126 predicted 474
11 SASI_Mm01_00185045 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001767
CD2 MISSION shRNA Bacterial Glycerol Stock
CD2 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-336s21c1
Sequence:CCGGGATATCTACAAGGTATCAATACTCGAGTATTGATACCTTGTAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-181s21c1
Sequence:CCGGGTGATGATATTGACGATATAACTCGAGTTATATCGTCAATATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001767.3-1379s21c1
Sequence:CCGGTCATGTGTAGATGCGATAAATCTCGAGATTTATCGCATCTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-658s21c1
Sequence:CCGGTCTATCTCATCATTGGCATATCTCGAGATATGCCAATGATGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001767.2-1326s1c1
Sequence:CCGGGCACAGAAATCTTAGAGATTTCTCGAGAAATCTCTAAGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-128s1c1
Sequence:CCGGCAGGACATCAACTTGGACATTCTCGAGAATGTCCAAGTTGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-635s1c1
Sequence:CCGGCTGGACATCTATCTCATCATTCTCGAGAATGATGAGATAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-473s1c1
Sequence:CCGGCCCGAATTAAACCTGTATCAACTCGAGTTGATACAGGTTTAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-807s1c1
Sequence:CCGGCCCAACAAATTCCAGCTTCAACTCGAGTTGAAGCTGGAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001767
CD2 MISSION shRNA shRNA Plasmid DNA
CD2 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-336s21c1
Sequence:CCGGGATATCTACAAGGTATCAATACTCGAGTATTGATACCTTGTAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-181s21c1
Sequence:CCGGGTGATGATATTGACGATATAACTCGAGTTATATCGTCAATATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001767.3-1379s21c1
Sequence:CCGGTCATGTGTAGATGCGATAAATCTCGAGATTTATCGCATCTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-658s21c1
Sequence:CCGGTCTATCTCATCATTGGCATATCTCGAGATATGCCAATGATGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001767.2-1326s1c1
Sequence:CCGGGCACAGAAATCTTAGAGATTTCTCGAGAAATCTCTAAGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-128s1c1
Sequence:CCGGCAGGACATCAACTTGGACATTCTCGAGAATGTCCAAGTTGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-635s1c1
Sequence:CCGGCTGGACATCTATCTCATCATTCTCGAGAATGATGAGATAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-473s1c1
Sequence:CCGGCCCGAATTAAACCTGTATCAACTCGAGTTGATACAGGTTTAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-807s1c1
Sequence:CCGGCCCAACAAATTCCAGCTTCAACTCGAGTTGAAGCTGGAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001767
CD2 MISSION shRNA Lentiviral Transduction Particles
CD2 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-336s21c1
Sequence:CCGGGATATCTACAAGGTATCAATACTCGAGTATTGATACCTTGTAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-181s21c1
Sequence:CCGGGTGATGATATTGACGATATAACTCGAGTTATATCGTCAATATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001767.3-1379s21c1
Sequence:CCGGTCATGTGTAGATGCGATAAATCTCGAGATTTATCGCATCTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001767.3-658s21c1
Sequence:CCGGTCTATCTCATCATTGGCATATCTCGAGATATGCCAATGATGAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001767.2-1326s1c1
Sequence:CCGGGCACAGAAATCTTAGAGATTTCTCGAGAAATCTCTAAGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-128s1c1
Sequence:CCGGCAGGACATCAACTTGGACATTCTCGAGAATGTCCAAGTTGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-635s1c1
Sequence:CCGGCTGGACATCTATCTCATCATTCTCGAGAATGATGAGATAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-473s1c1
Sequence:CCGGCCCGAATTAAACCTGTATCAACTCGAGTTGATACAGGTTTAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001767.2-807s1c1
Sequence:CCGGCCCAACAAATTCCAGCTTCAACTCGAGTTGAAGCTGGAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013486
VALIDATED
CD2 MISSION shRNA Bacterial Glycerol Stock
CD2 molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-234s21c1
Sequence:CCGGCACCCTGGTCGCAGAGTTTAACTCGAGTTAAACTCTGCGACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-591s21c1
Sequence:CCGGATTCAAGTGTGAGGCGATAAACTCGAGTTTATCGCCTCACACTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-341s21c1
Sequence:CCGGACGACAGTGGCACCTATAATGCTCGAGCATTATAGGTGCCACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-627s21c1
Sequence:CCGGGTCTAAGATGGAAGTTGTTAACTCGAGTTAACAACTTCCATCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-186s21c1
Sequence:CCGGCTTTCAAATGACTGATGATATCTCGAGATATCATCAGTCATTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-181s1c1
Sequence:CCGGCCCAACTTTCAAATGACTGATCTCGAGATCAGTCATTTGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-350s1c1
Sequence:CCGGGCACCTATAATGTAATGGTGTCTCGAGACACCATTACATTATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-738s1c1
Sequence:CCGGCTGTATCTGCAAGAGGAGAAACTCGAGTTTCTCCTCTTGCAGATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-991s1c1
Sequence:CCGGACACAGATTCACCAGCAGAAACTCGAGTTTCTGCTGGTGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013486.1-589s1c1
Sequence:CCGGCCATTCAAGTGTGAGGCGATACTCGAGTATCGCCTCACACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013486
VALIDATED
CD2 MISSION shRNA shRNA Plasmid DNA
CD2 molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-234s21c1
Sequence:CCGGCACCCTGGTCGCAGAGTTTAACTCGAGTTAAACTCTGCGACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-591s21c1
Sequence:CCGGATTCAAGTGTGAGGCGATAAACTCGAGTTTATCGCCTCACACTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-341s21c1
Sequence:CCGGACGACAGTGGCACCTATAATGCTCGAGCATTATAGGTGCCACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-627s21c1
Sequence:CCGGGTCTAAGATGGAAGTTGTTAACTCGAGTTAACAACTTCCATCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-186s21c1
Sequence:CCGGCTTTCAAATGACTGATGATATCTCGAGATATCATCAGTCATTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-181s1c1
Sequence:CCGGCCCAACTTTCAAATGACTGATCTCGAGATCAGTCATTTGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-350s1c1
Sequence:CCGGGCACCTATAATGTAATGGTGTCTCGAGACACCATTACATTATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-738s1c1
Sequence:CCGGCTGTATCTGCAAGAGGAGAAACTCGAGTTTCTCCTCTTGCAGATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-991s1c1
Sequence:CCGGACACAGATTCACCAGCAGAAACTCGAGTTTCTGCTGGTGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013486.1-589s1c1
Sequence:CCGGCCATTCAAGTGTGAGGCGATACTCGAGTATCGCCTCACACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013486
VALIDATED
CD2 MISSION shRNA Lentiviral Transduction Particles
CD2 molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-234s21c1
Sequence:CCGGCACCCTGGTCGCAGAGTTTAACTCGAGTTAAACTCTGCGACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-591s21c1
Sequence:CCGGATTCAAGTGTGAGGCGATAAACTCGAGTTTATCGCCTCACACTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-341s21c1
Sequence:CCGGACGACAGTGGCACCTATAATGCTCGAGCATTATAGGTGCCACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-627s21c1
Sequence:CCGGGTCTAAGATGGAAGTTGTTAACTCGAGTTAACAACTTCCATCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013486.2-186s21c1
Sequence:CCGGCTTTCAAATGACTGATGATATCTCGAGATATCATCAGTCATTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-181s1c1
Sequence:CCGGCCCAACTTTCAAATGACTGATCTCGAGATCAGTCATTTGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-350s1c1
Sequence:CCGGGCACCTATAATGTAATGGTGTCTCGAGACACCATTACATTATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-738s1c1
Sequence:CCGGCTGTATCTGCAAGAGGAGAAACTCGAGTTTCTCCTCTTGCAGATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013486.1-991s1c1
Sequence:CCGGACACAGATTCACCAGCAGAAACTCGAGTTTCTGCTGGTGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013486.1-589s1c1
Sequence:CCGGCCATTCAAGTGTGAGGCGATACTCGAGTATCGCCTCACACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks