EMAIL THIS PAGE TO A FRIEND

CD2AP

CD2-associated protein

157 Gene Product Result for
Synonyms: CMS
UniProtKB ID: Q9Y5K6, A6NL34, Q5VYA3, Q9UG97
Gene ID:
Human(23607) Summary: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. Haploinsufficiency of this gene is implicated in susceptibility to glomerular disease. [provided by RefSeq, Jul 2008]
Mouse(12488) CD2-associated protein
Rat(316258) CD2-associated protein
naked mole-rat(101713086) CD2-associated protein
domestic guinea pig(100731393) CD2-associated protein
sheep(101117542) CD2-associated protein
Domestic Rabbit(100341696) CD2-associated protein
Zebrafish(494040) CD2-associated protein
domestic cat(101091623) CD2-associated protein
dog(474928) CD2-associated protein
cow(533188) CD2-associated protein
chicken(771715) CD2-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012120 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015821 MISSION® esiRNA esiRNA targeting human CD2AP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012120 Rosetta Predictions human pricing
NM_181475 Rosetta Predictions rat pricing
NM_009847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151362 predicted 842
2 SASI_Hs02_00343664 predicted 911
3 SASI_Hs01_00151363 predicted 1403
4 SASI_Hs01_00151364 predicted 1758
5 SASI_Hs02_00343665 predicted 736
6 SASI_Hs01_00151366 predicted 2407
7 SASI_Hs01_00151367 predicted 775
8 SASI_Hs01_00151368 predicted 1820
9 SASI_Hs01_00151369 predicted 688
10 SASI_Hs01_00151370 predicted 933
11 SASI_Hs01_00151365 predicted 440
12 SASI_Hs01_00151371 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117405 predicted 684
2 SASI_Rn02_00269748 predicted 1684
3 SASI_Rn01_00117406 predicted 634
4 SASI_Rn01_00117407 predicted 454
5 SASI_Rn01_00117408 predicted 758
6 SASI_Rn02_00269749 predicted 792
7 SASI_Rn02_00269750 predicted 1453
8 SASI_Rn02_00269751 predicted 1294
9 SASI_Rn01_00117413 predicted 605
10 SASI_Rn01_00117414 predicted 480
11 SASI_Rn01_00117409 predicted 967
12 SASI_Rn01_00117410 predicted 1288
13 SASI_Rn01_00117411 predicted 978
14 SASI_Rn01_00117412 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317225 predicted 1692
2 SASI_Mm01_00072231 predicted 1048
3 SASI_Mm01_00072232 predicted 696
4 SASI_Mm02_00317226 predicted 1794
5 SASI_Mm01_00072233 predicted 557
6 SASI_Mm02_00317227 predicted 917
7 SASI_Mm01_00072225 predicted 1458
8 SASI_Mm02_00317228 predicted 1866
9 SASI_Mm01_00072226 predicted 939
10 SASI_Mm02_00317229 predicted 1877
11 SASI_Mm01_00072224 predicted 871
12 SASI_Mm01_00072227 predicted 1155
13 SASI_Mm01_00072228 predicted 1536
14 SASI_Mm01_00072229 predicted 1201
15 SASI_Mm01_00072230 predicted 1534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009847
VALIDATED
CD2AP MISSION shRNA Bacterial Glycerol Stock
CD2-associated protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1037s21c1
Sequence:CCGGAGGGTGAACTGAACGGTAAAGCTCGAGCTTTACCGTTCAGTTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1855s21c1
Sequence:CCGGGAACTTAGAGCCCAGATTATTCTCGAGAATAATCTGGGCTCTAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009847.3-2958s21c1
Sequence:CCGGCAAACCTAAACCCAGATATTTCTCGAGAAATATCTGGGTTTAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009847.3-895s21c1
Sequence:CCGGGACGTTGATGGCAAGATTAAACTCGAGTTTAATCTTGCCATCAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1954s21c1
Sequence:CCGGGAGAAGGCCATGCGAAGTAATCTCGAGATTACTTCGCATGGCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009847.2-4562s1c1
Sequence:CCGGGCCAGTATTTGCCCTTGATATCTCGAGATATCAAGGGCAAATACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-129s1c1
Sequence:CCGGGATGAGTTAACTATCCGAGTTCTCGAGAACTCGGATAGTTAACTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-1829s1c1
Sequence:CCGGCGAACTTAGAGCCCAGATTATCTCGAGATAATCTGGGCTCTAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009847
VALIDATED
CD2AP MISSION shRNA shRNA Plasmid DNA
CD2-associated protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1037s21c1
Sequence:CCGGAGGGTGAACTGAACGGTAAAGCTCGAGCTTTACCGTTCAGTTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1855s21c1
Sequence:CCGGGAACTTAGAGCCCAGATTATTCTCGAGAATAATCTGGGCTCTAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009847.3-2958s21c1
Sequence:CCGGCAAACCTAAACCCAGATATTTCTCGAGAAATATCTGGGTTTAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009847.3-895s21c1
Sequence:CCGGGACGTTGATGGCAAGATTAAACTCGAGTTTAATCTTGCCATCAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1954s21c1
Sequence:CCGGGAGAAGGCCATGCGAAGTAATCTCGAGATTACTTCGCATGGCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009847.2-4562s1c1
Sequence:CCGGGCCAGTATTTGCCCTTGATATCTCGAGATATCAAGGGCAAATACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-129s1c1
Sequence:CCGGGATGAGTTAACTATCCGAGTTCTCGAGAACTCGGATAGTTAACTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-1829s1c1
Sequence:CCGGCGAACTTAGAGCCCAGATTATCTCGAGATAATCTGGGCTCTAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009847
VALIDATED
CD2AP MISSION shRNA Lentiviral Transduction Particles
CD2-associated protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1037s21c1
Sequence:CCGGAGGGTGAACTGAACGGTAAAGCTCGAGCTTTACCGTTCAGTTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1855s21c1
Sequence:CCGGGAACTTAGAGCCCAGATTATTCTCGAGAATAATCTGGGCTCTAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009847.3-2958s21c1
Sequence:CCGGCAAACCTAAACCCAGATATTTCTCGAGAAATATCTGGGTTTAGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009847.3-895s21c1
Sequence:CCGGGACGTTGATGGCAAGATTAAACTCGAGTTTAATCTTGCCATCAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009847.3-1954s21c1
Sequence:CCGGGAGAAGGCCATGCGAAGTAATCTCGAGATTACTTCGCATGGCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009847.2-4562s1c1
Sequence:CCGGGCCAGTATTTGCCCTTGATATCTCGAGATATCAAGGGCAAATACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-129s1c1
Sequence:CCGGGATGAGTTAACTATCCGAGTTCTCGAGAACTCGGATAGTTAACTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009847.2-1829s1c1
Sequence:CCGGCGAACTTAGAGCCCAGATTATCTCGAGATAATCTGGGCTCTAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012120
CD2AP MISSION shRNA Bacterial Glycerol Stock
CD2-associated protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012120.1-2795s1c1
Sequence:CCGGGCCTAGAAACTACAGCACATACTCGAGTATGTGCTGTAGTTTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-198s1c1
Sequence:CCGGCCTGACAATTTCGTTAAGGAACTCGAGTTCCTTAACGAAATTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1023s1c1
Sequence:CCGGGCTGTCCAGATAAATGAACTTCTCGAGAAGTTCATTTATCTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1558s1c1
Sequence:CCGGGCCGTTTCAATGGTGGACATTCTCGAGAATGTCCACCATTGAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-199s1c1
Sequence:CCGGCTGACAATTTCGTTAAGGAAACTCGAGTTTCCTTAACGAAATTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012120
CD2AP MISSION shRNA shRNA Plasmid DNA
CD2-associated protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012120.1-2795s1c1
Sequence:CCGGGCCTAGAAACTACAGCACATACTCGAGTATGTGCTGTAGTTTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-198s1c1
Sequence:CCGGCCTGACAATTTCGTTAAGGAACTCGAGTTCCTTAACGAAATTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1023s1c1
Sequence:CCGGGCTGTCCAGATAAATGAACTTCTCGAGAAGTTCATTTATCTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1558s1c1
Sequence:CCGGGCCGTTTCAATGGTGGACATTCTCGAGAATGTCCACCATTGAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-199s1c1
Sequence:CCGGCTGACAATTTCGTTAAGGAAACTCGAGTTTCCTTAACGAAATTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012120
CD2AP MISSION shRNA Lentiviral Transduction Particles
CD2-associated protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012120.1-2795s1c1
Sequence:CCGGGCCTAGAAACTACAGCACATACTCGAGTATGTGCTGTAGTTTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-198s1c1
Sequence:CCGGCCTGACAATTTCGTTAAGGAACTCGAGTTCCTTAACGAAATTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1023s1c1
Sequence:CCGGGCTGTCCAGATAAATGAACTTCTCGAGAAGTTCATTTATCTGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-1558s1c1
Sequence:CCGGGCCGTTTCAATGGTGGACATTCTCGAGAATGTCCACCATTGAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012120.1-199s1c1
Sequence:CCGGCTGACAATTTCGTTAAGGAAACTCGAGTTTCCTTAACGAAATTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)