EMAIL THIS PAGE TO A FRIEND

CD2BP2

CD2 (cytoplasmic tail) binding protein 2

64 Gene Product Result for
Synonyms: FWP010 LIN1 PPP1R59 Snu40 U5-52K
UniProtKB ID: O95400, B2RDX2, Q9ULP2
Gene ID:
Human(10421) Summary: This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Mouse(70233) CD2 antigen (cytoplasmic tail) binding protein 2
Rat(293505) Cd2 (cytoplasmic tail) binding protein 2
Zebrafish(393936) CD2 antigen (cytoplasmic tail) binding protein 2
cow(513857) CD2 (cytoplasmic tail) binding protein 2
domestic cat(101095066) CD2 (cytoplasmic tail) binding protein 2
dog(489937) CD2 (cytoplasmic tail) binding protein 2
sheep(101120718) CD2 (cytoplasmic tail) binding protein 2
domestic guinea pig(100735691) CD2 (cytoplasmic tail) binding protein 2
naked mole-rat(101720001) CD2 (cytoplasmic tail) binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006110 Rosetta Predictions human pricing
NM_001106297 Rosetta Predictions rat pricing
NM_027353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021904 predicted 464
2 SASI_Hs01_00021905 predicted 1046
3 SASI_Hs01_00021906 predicted 937
4 SASI_Hs01_00021907 predicted 462
5 SASI_Hs01_00021908 predicted 1052
6 SASI_Hs02_00340909 predicted 311
7 SASI_Hs01_00021909 predicted 365
8 SASI_Hs01_00021910 predicted 603
9 SASI_Hs02_00340910 predicted 316
10 SASI_Hs01_00021911 predicted 310
11 SASI_Hs01_00021912 predicted 239
12 SASI_Hs01_00021913 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217588 predicted 1455
2 SASI_Rn02_00217589 predicted 1489
3 SASI_Rn02_00217590 predicted 954
4 SASI_Rn02_00217591 predicted 326
5 SASI_Rn02_00217592 predicted 340
6 SASI_Rn02_00217593 predicted 1187
7 SASI_Rn02_00217594 predicted 1468
8 SASI_Rn02_00217595 predicted 868
9 SASI_Rn02_00217596 predicted 407
10 SASI_Rn02_00217597 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064471 predicted 1585
2 SASI_Mm01_00064472 predicted 338
3 SASI_Mm01_00064473 predicted 771
4 SASI_Mm01_00064474 predicted 980
5 SASI_Mm01_00064475 predicted 1609
6 SASI_Mm01_00064476 predicted 726
7 SASI_Mm01_00064477 predicted 317
8 SASI_Mm01_00064478 predicted 290
9 SASI_Mm01_00064479 predicted 215
10 SASI_Mm01_00064480 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006110
VALIDATED
CD2BP2 MISSION shRNA Bacterial Glycerol Stock
CD2 (cytoplasmic tail) binding protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006110.1-372s1c1
Sequence:CCGGTGTTCGGATCACACCCTTTAACTCGAGTTAAAGGGTGTGATCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-1121s1c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-955s1c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-769s1c1
Sequence:CCGGGTGTACCAGGAAACAAGGGAACTCGAGTTCCCTTGTTTCCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-236s1c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1265s21c1
Sequence:GTACCGGTGTCTCAGGCAGCGAGGAAATCTCGAGATTTCCTCGCTGCCTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1109s21c1
Sequence:CCGGCTACTTCCCGGACGGTGTTTACTCGAGTAAACACCGTCCGGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1177s21c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-292s21c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1478s21c1
Sequence:CCGGGGACTCTGCTTGCCGTGTAAACTCGAGTTTACACGGCAAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1011s21c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006110
VALIDATED
CD2BP2 MISSION shRNA shRNA Plasmid DNA
CD2 (cytoplasmic tail) binding protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006110.1-372s1c1
Sequence:CCGGTGTTCGGATCACACCCTTTAACTCGAGTTAAAGGGTGTGATCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-1121s1c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-955s1c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-769s1c1
Sequence:CCGGGTGTACCAGGAAACAAGGGAACTCGAGTTCCCTTGTTTCCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-236s1c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1265s21c1
Sequence:GTACCGGTGTCTCAGGCAGCGAGGAAATCTCGAGATTTCCTCGCTGCCTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1109s21c1
Sequence:CCGGCTACTTCCCGGACGGTGTTTACTCGAGTAAACACCGTCCGGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1177s21c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-292s21c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1478s21c1
Sequence:CCGGGGACTCTGCTTGCCGTGTAAACTCGAGTTTACACGGCAAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1011s21c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006110
VALIDATED
CD2BP2 MISSION shRNA Lentiviral Transduction Particles
CD2 (cytoplasmic tail) binding protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006110.1-372s1c1
Sequence:CCGGTGTTCGGATCACACCCTTTAACTCGAGTTAAAGGGTGTGATCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-1121s1c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-955s1c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-769s1c1
Sequence:CCGGGTGTACCAGGAAACAAGGGAACTCGAGTTCCCTTGTTTCCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006110.1-236s1c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1265s21c1
Sequence:GTACCGGTGTCTCAGGCAGCGAGGAAATCTCGAGATTTCCTCGCTGCCTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1109s21c1
Sequence:CCGGCTACTTCCCGGACGGTGTTTACTCGAGTAAACACCGTCCGGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1177s21c1
Sequence:CCGGGCATTGACTTTGACCTCTACACTCGAGTGTAGAGGTCAAAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-292s21c1
Sequence:CCGGGCCGCTTTAAAGGCAAACACTCTCGAGAGTGTTTGCCTTTAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006110.2-1478s21c1
Sequence:CCGGGGACTCTGCTTGCCGTGTAAACTCGAGTTTACACGGCAAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006110.2-1011s21c1
Sequence:CCGGGTGGATGTGATGTGGGAATATCTCGAGATATTCCCACATCACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027353
VALIDATED
CD2BP2 MISSION shRNA Bacterial Glycerol Stock
CD2 (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027353.2-2684s1c1
Sequence:CCGGCCTTTGATTATTTGGGCCATTCTCGAGAATGGCCCAAATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-945s1c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-345s1c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027353.2-229s1c1
Sequence:CCGGCACTCTTTAGACAGTGATGAACTCGAGTTCATCACTGTCTAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-753s1c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027353.3-1599s21c1
Sequence:CCGGCCTATTGAGAGATTCTCTTAACTCGAGTTAAGAGAATCTCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-944s21c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-752s21c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-344s21c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-266s21c1
Sequence:CCGGAGGGTCCAGCAAATATGATATCTCGAGATATCATATTTGCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027353
VALIDATED
CD2BP2 MISSION shRNA shRNA Plasmid DNA
CD2 (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027353.2-2684s1c1
Sequence:CCGGCCTTTGATTATTTGGGCCATTCTCGAGAATGGCCCAAATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-945s1c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-345s1c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027353.2-229s1c1
Sequence:CCGGCACTCTTTAGACAGTGATGAACTCGAGTTCATCACTGTCTAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-753s1c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027353.3-1599s21c1
Sequence:CCGGCCTATTGAGAGATTCTCTTAACTCGAGTTAAGAGAATCTCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-944s21c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-752s21c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-344s21c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-266s21c1
Sequence:CCGGAGGGTCCAGCAAATATGATATCTCGAGATATCATATTTGCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027353
VALIDATED
CD2BP2 MISSION shRNA Lentiviral Transduction Particles
CD2 (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027353.2-2684s1c1
Sequence:CCGGCCTTTGATTATTTGGGCCATTCTCGAGAATGGCCCAAATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-945s1c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-345s1c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027353.2-229s1c1
Sequence:CCGGCACTCTTTAGACAGTGATGAACTCGAGTTCATCACTGTCTAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027353.2-753s1c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027353.3-1599s21c1
Sequence:CCGGCCTATTGAGAGATTCTCTTAACTCGAGTTAAGAGAATCTCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-944s21c1
Sequence:CCGGGTGGGAGTATAAATGGGAGAACTCGAGTTCTCCCATTTATACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-752s21c1
Sequence:CCGGCCAGGAAACAAGGGAACGGTTCTCGAGAACCGTTCCCTTGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-344s21c1
Sequence:CCGGTGTGAGGATCACACCCTTCAACTCGAGTTGAAGGGTGTGATCCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027353.3-266s21c1
Sequence:CCGGAGGGTCCAGCAAATATGATATCTCGAGATATCATATTTGCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks