EMAIL THIS PAGE TO A FRIEND

CD300A

CD300a molecule

59 Gene Product Result for
Synonyms: CLM-8 CMRF-35-H9 CMRF-35H CMRF35-H CMRF35-H9 CMRF35H CMRF35H9 IGSF12 IRC1 IRC1/IRC2 IRC2 IRp60
Gene ID:
Human(11314) Summary: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(217303) CD300A antigen
Rat(501736) Cd300a molecule
chicken(422107) CD300a molecule
cow(516915) CD300a molecule
domestic cat(101088701) CD300a molecule
dog(483289) CD300a molecule
naked mole-rat(101724026) CD300a molecule
sheep(101112832) CD300a molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1328 Human CD300a ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067921 MISSION® esiRNA esiRNA targeting mouse Cd300a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007261 Rosetta Predictions human pricing
XM_001081646 Rosetta Predictions rat pricing
XM_577137 Rosetta Predictions rat pricing
NM_170758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159763 predicted 1125
2 SASI_Hs01_00159764 predicted 1181
3 SASI_Hs01_00159765 predicted 1199
4 SASI_Hs01_00159766 predicted 944
5 SASI_Hs01_00159767 predicted 704
6 SASI_Hs01_00159768 predicted 932
7 SASI_Hs01_00159769 predicted 703
8 SASI_Hs01_00159770 predicted 916
9 SASI_Hs01_00159771 predicted 1184
10 SASI_Hs02_00343293 predicted 760
11 SASI_Hs01_00159772 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372828 predicted 815
2 SASI_Rn02_00372829 predicted 933
3 SASI_Rn02_00372830 predicted 1345
4 SASI_Rn02_00372831 predicted 613
5 SASI_Rn02_00372832 predicted 738
6 SASI_Rn02_00372833 predicted 1279
7 SASI_Rn02_00372834 predicted 587
8 SASI_Rn02_00372835 predicted 835
9 SASI_Rn02_00372836 predicted 1252
10 SASI_Rn02_00372837 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123525 predicted 397
2 SASI_Rn01_00123526 predicted 439
3 SASI_Rn01_00123527 predicted 312
4 SASI_Rn01_00123528 predicted 447
5 SASI_Rn01_00123529 predicted 317
6 SASI_Rn01_00123530 predicted 249
7 SASI_Rn01_00123531 predicted 434
8 SASI_Rn01_00123532 predicted 447
9 SASI_Rn01_00123533 predicted 376
10 SASI_Rn01_00123534 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343609 predicted 458
2 SASI_Mm02_00343610 predicted 1091
3 SASI_Mm02_00343611 predicted 1183
4 SASI_Mm02_00343612 predicted 508
5 SASI_Mm02_00343613 predicted 457
6 SASI_Mm02_00343614 predicted 1087
7 SASI_Mm02_00343615 predicted 1261
8 SASI_Mm02_00343616 predicted 1152
9 SASI_Mm02_00343617 predicted 1166
10 SASI_Mm02_00343618 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170758
CD300A MISSION shRNA Bacterial Glycerol Stock
CD300a molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-839s1c1
Sequence:CCGGGCCACCGTGAACATGACTATTCTCGAGAATAGTCATGTTCACGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1014s1c1
Sequence:CCGGTGAGCAGAATGAGTGCCAGTACTCGAGTACTGGCACTCATTCTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170758.2-2560s1c1
Sequence:CCGGGCCACTTCTTACAACTCTTAACTCGAGTTAAGAGTTGTAAGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-447s1c1
Sequence:CCGGCCTGAGTGTGTCATGTCGATACTCGAGTATCGACATGACACACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1186s1c1
Sequence:CCGGGCCAATGGAGATTCTCTTCATCTCGAGATGAAGAGAATCTCCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170758
CD300A MISSION shRNA shRNA Plasmid DNA
CD300a molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-839s1c1
Sequence:CCGGGCCACCGTGAACATGACTATTCTCGAGAATAGTCATGTTCACGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1014s1c1
Sequence:CCGGTGAGCAGAATGAGTGCCAGTACTCGAGTACTGGCACTCATTCTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170758.2-2560s1c1
Sequence:CCGGGCCACTTCTTACAACTCTTAACTCGAGTTAAGAGTTGTAAGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-447s1c1
Sequence:CCGGCCTGAGTGTGTCATGTCGATACTCGAGTATCGACATGACACACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1186s1c1
Sequence:CCGGGCCAATGGAGATTCTCTTCATCTCGAGATGAAGAGAATCTCCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170758
CD300A MISSION shRNA Lentiviral Transduction Particles
CD300a molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-839s1c1
Sequence:CCGGGCCACCGTGAACATGACTATTCTCGAGAATAGTCATGTTCACGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1014s1c1
Sequence:CCGGTGAGCAGAATGAGTGCCAGTACTCGAGTACTGGCACTCATTCTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170758.2-2560s1c1
Sequence:CCGGGCCACTTCTTACAACTCTTAACTCGAGTTAAGAGTTGTAAGAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-447s1c1
Sequence:CCGGCCTGAGTGTGTCATGTCGATACTCGAGTATCGACATGACACACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170758.2-1186s1c1
Sequence:CCGGGCCAATGGAGATTCTCTTCATCTCGAGATGAAGAGAATCTCCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007261
CD300A MISSION shRNA Bacterial Glycerol Stock
CD300a molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-675s1c1
Sequence:CCGGGCCTGGAGGATGTTTCAGAAACTCGAGTTTCTGAAACATCCTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-208s1c1
Sequence:CCGGCCCTCAACAAATACTGGTGCACTCGAGTGCACCAGTATTTGTTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-348s1c1
Sequence:CCGGGAGAATCTCACAGAGGAGGATCTCGAGATCCTCCTCTGTGAGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-701s1c1
Sequence:CCGGCAAATGGATCAAAGCTGGTGACTCGAGTCACCAGCTTTGATCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-954s1c1
Sequence:CCGGGATTCAGATTACAGTGTGATACTCGAGTATCACACTGTAATCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-683s1c1
Sequence:CCGGGATGTTTCAGAAATGGATCAACTCGAGTTGATCCATTTCTGAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-867s1c1
Sequence:CCGGCCCAGGGAAGAACTTCACTATCTCGAGATAGTGAAGTTCTTCCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-408s1c1
Sequence:CCGGCGAGACTTTCATGATCCCGTTCTCGAGAACGGGATCATGAAAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-180s1c1
Sequence:CCGGCAGTGTCCCTATGAGAAGGAACTCGAGTTCCTTCTCATAGGGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007261
CD300A MISSION shRNA shRNA Plasmid DNA
CD300a molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-675s1c1
Sequence:CCGGGCCTGGAGGATGTTTCAGAAACTCGAGTTTCTGAAACATCCTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-208s1c1
Sequence:CCGGCCCTCAACAAATACTGGTGCACTCGAGTGCACCAGTATTTGTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-348s1c1
Sequence:CCGGGAGAATCTCACAGAGGAGGATCTCGAGATCCTCCTCTGTGAGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-701s1c1
Sequence:CCGGCAAATGGATCAAAGCTGGTGACTCGAGTCACCAGCTTTGATCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-954s1c1
Sequence:CCGGGATTCAGATTACAGTGTGATACTCGAGTATCACACTGTAATCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-683s1c1
Sequence:CCGGGATGTTTCAGAAATGGATCAACTCGAGTTGATCCATTTCTGAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-867s1c1
Sequence:CCGGCCCAGGGAAGAACTTCACTATCTCGAGATAGTGAAGTTCTTCCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-408s1c1
Sequence:CCGGCGAGACTTTCATGATCCCGTTCTCGAGAACGGGATCATGAAAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-180s1c1
Sequence:CCGGCAGTGTCCCTATGAGAAGGAACTCGAGTTCCTTCTCATAGGGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007261
CD300A MISSION shRNA Lentiviral Transduction Particles
CD300a molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-675s1c1
Sequence:CCGGGCCTGGAGGATGTTTCAGAAACTCGAGTTTCTGAAACATCCTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-208s1c1
Sequence:CCGGCCCTCAACAAATACTGGTGCACTCGAGTGCACCAGTATTTGTTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-348s1c1
Sequence:CCGGGAGAATCTCACAGAGGAGGATCTCGAGATCCTCCTCTGTGAGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-701s1c1
Sequence:CCGGCAAATGGATCAAAGCTGGTGACTCGAGTCACCAGCTTTGATCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-954s1c1
Sequence:CCGGGATTCAGATTACAGTGTGATACTCGAGTATCACACTGTAATCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-683s1c1
Sequence:CCGGGATGTTTCAGAAATGGATCAACTCGAGTTGATCCATTTCTGAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-867s1c1
Sequence:CCGGCCCAGGGAAGAACTTCACTATCTCGAGATAGTGAAGTTCTTCCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-408s1c1
Sequence:CCGGCGAGACTTTCATGATCCCGTTCTCGAGAACGGGATCATGAAAGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007261.1-180s1c1
Sequence:CCGGCAGTGTCCCTATGAGAAGGAACTCGAGTTCCTTCTCATAGGGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)