EMAIL THIS PAGE TO A FRIEND

CD300C

CD300c molecule

Synonyms: CLM-6 CMRF-35 CMRF-35A CMRF35 CMRF35-A1 CMRF35A CMRF35A1 IGSF16 LIR
UniProtKB ID: Q08708
Gene ID:
Human(10871) Summary: The CMRF35 antigen, which was identified by reactivity with a monoclonal antibody, is present on monocytes, neutrophils, and some T and B lymphocytes (Jackson et al., 1992 [PubMed 1349532]
Mouse(387565) CD300C antigen
dog(609800) CD300c molecule
domestic cat(101089223) CD300c molecule
cow(100336452) CD300c molecule
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1329 Human CD300c ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006678 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118861 MISSION® esiRNA esiRNA human CD300C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006678 Rosetta Predictions human pricing
NM_199225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069009 predicted 402
2 SASI_Hs01_00069010 predicted 806
3 SASI_Hs01_00069011 predicted 999
4 SASI_Hs01_00069012 predicted 982
5 SASI_Hs01_00069013 predicted 1221
6 SASI_Hs02_00342082 predicted 1478
7 SASI_Hs01_00069018 predicted 1362
8 SASI_Hs02_00342083 predicted 1443
9 SASI_Hs01_00069014 predicted 1382
10 SASI_Hs01_00069015 predicted 1445
11 SASI_Hs01_00069016 predicted 1469
12 SASI_Hs01_00069017 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166431 predicted 431
2 SASI_Mm01_00166432 predicted 398
3 SASI_Mm01_00166433 predicted 406
4 SASI_Mm01_00166434 predicted 384
5 SASI_Mm01_00166435 predicted 425
6 SASI_Mm01_00166436 predicted 430
7 SASI_Mm01_00166439 predicted 411
8 SASI_Mm01_00166440 predicted 421
9 SASI_Mm02_00351401 predicted 428
10 SASI_Mm02_00351402 predicted 391
11 SASI_Mm01_00166437 predicted 436
12 SASI_Mm01_00166438 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199225
CD300C MISSION shRNA Bacterial Glycerol Stock
CD300c molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-165s1c1
Sequence:CCGGCTGGTGCAAATGGAAATCTAACTCGAGTTAGATTTCCATTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-125s1c1
Sequence:CCGGCCTGTCAGTATGAGAAGAAATCTCGAGATTTCTTCTCATACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-436s1c1
Sequence:CCGGCCTGGGAACGGTATCAACATTCTCGAGAATGTTGATACCGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-217s1c1
Sequence:CCGGGCCTCAGAAGAAGCTAGGAATCTCGAGATTCCTAGCTTCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-355s1c1
Sequence:CCGGGATGCCTACTTACAGATCGATCTCGAGATCGATCTGTAAGTAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199225
CD300C MISSION shRNA shRNA Plasmid DNA
CD300c molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-165s1c1
Sequence:CCGGCTGGTGCAAATGGAAATCTAACTCGAGTTAGATTTCCATTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-125s1c1
Sequence:CCGGCCTGTCAGTATGAGAAGAAATCTCGAGATTTCTTCTCATACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-436s1c1
Sequence:CCGGCCTGGGAACGGTATCAACATTCTCGAGAATGTTGATACCGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-217s1c1
Sequence:CCGGGCCTCAGAAGAAGCTAGGAATCTCGAGATTCCTAGCTTCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-355s1c1
Sequence:CCGGGATGCCTACTTACAGATCGATCTCGAGATCGATCTGTAAGTAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199225
CD300C MISSION shRNA Lentiviral Transduction Particles
CD300c molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-165s1c1
Sequence:CCGGCTGGTGCAAATGGAAATCTAACTCGAGTTAGATTTCCATTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-125s1c1
Sequence:CCGGCCTGTCAGTATGAGAAGAAATCTCGAGATTTCTTCTCATACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-436s1c1
Sequence:CCGGCCTGGGAACGGTATCAACATTCTCGAGAATGTTGATACCGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-217s1c1
Sequence:CCGGGCCTCAGAAGAAGCTAGGAATCTCGAGATTCCTAGCTTCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199225.1-355s1c1
Sequence:CCGGGATGCCTACTTACAGATCGATCTCGAGATCGATCTGTAAGTAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006678
CD300C MISSION shRNA Bacterial Glycerol Stock
CD300c molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-557s1c1
Sequence:CCGGGACAAGATTGTGGAGACCAAACTCGAGTTTGGTCTCCACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-1004s1c1
Sequence:CCGGAGGCAGAATTGGCCCAAGGGTCTCGAGACCCTTGGGCCAATTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-713s1c1
Sequence:CCGGCGAGACTTTCATGATCCCATTCTCGAGAATGGGATCATGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-801s1c1
Sequence:CCGGGCACCTCAGGTCCTCCCACGACTCGAGTCGTGGGAGGACCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-892s1c1
Sequence:CCGGCCTGTTCAGCAATGTCCGCTTCTCGAGAAGCGGACATTGCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006678.3-1225s21c1
Sequence:CCGGAGCTGTGAGTCCACGTCTCATCTCGAGATGAGACGTGGACTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006678.3-1034s21c1
Sequence:CCGGTAGCATCTGCTGTCCATCAAGCTCGAGCTTGATGGACAGCAGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006678
CD300C MISSION shRNA shRNA Plasmid DNA
CD300c molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-557s1c1
Sequence:CCGGGACAAGATTGTGGAGACCAAACTCGAGTTTGGTCTCCACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-1004s1c1
Sequence:CCGGAGGCAGAATTGGCCCAAGGGTCTCGAGACCCTTGGGCCAATTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-713s1c1
Sequence:CCGGCGAGACTTTCATGATCCCATTCTCGAGAATGGGATCATGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-801s1c1
Sequence:CCGGGCACCTCAGGTCCTCCCACGACTCGAGTCGTGGGAGGACCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-892s1c1
Sequence:CCGGCCTGTTCAGCAATGTCCGCTTCTCGAGAAGCGGACATTGCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006678.3-1225s21c1
Sequence:CCGGAGCTGTGAGTCCACGTCTCATCTCGAGATGAGACGTGGACTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006678.3-1034s21c1
Sequence:CCGGTAGCATCTGCTGTCCATCAAGCTCGAGCTTGATGGACAGCAGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006678
CD300C MISSION shRNA Lentiviral Transduction Particles
CD300c molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-557s1c1
Sequence:CCGGGACAAGATTGTGGAGACCAAACTCGAGTTTGGTCTCCACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-1004s1c1
Sequence:CCGGAGGCAGAATTGGCCCAAGGGTCTCGAGACCCTTGGGCCAATTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-713s1c1
Sequence:CCGGCGAGACTTTCATGATCCCATTCTCGAGAATGGGATCATGAAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-801s1c1
Sequence:CCGGGCACCTCAGGTCCTCCCACGACTCGAGTCGTGGGAGGACCTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006678.2-892s1c1
Sequence:CCGGCCTGTTCAGCAATGTCCGCTTCTCGAGAAGCGGACATTGCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006678.3-1225s21c1
Sequence:CCGGAGCTGTGAGTCCACGTCTCATCTCGAGATGAGACGTGGACTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006678.3-1034s21c1
Sequence:CCGGTAGCATCTGCTGTCCATCAAGCTCGAGCTTGATGGACAGCAGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks