EMAIL THIS PAGE TO A FRIEND

CD300E

CD300e molecule

47 Gene Product Result for
Synonyms: CD300LE CLM-2 CLM2 CMRF35-A5 IREM-2 IREM2 PIgR-2 PIgR2
UniProtKB ID: Q496F6, B4DNS1, Q7Z7I3
Gene ID:
Human(342510) Summary: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins expressed on myeloid cells. The protein interacts with the TYRO protein tyrosine kinase-binding protein and is thought to act as an activating receptor. [provided by RefSeq, Nov 2012]
Mouse(217306) CD300e antigen
Rat(690076) Cd300e molecule
dog(100686403) CD300e molecule
cow(524761) CD300e molecule
domestic cat(101090473) CD300e molecule
sheep(101103409) CD300e molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1330 Human CD300e ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150011 MISSION® esiRNA esiRNA human CD300E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181449 Rosetta Predictions human pricing
XM_001073158 Rosetta Predictions rat pricing
NM_172050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370059 predicted 331
2 SASI_Hs01_00126724 predicted 399
3 SASI_Hs01_00126725 predicted 353
4 SASI_Hs01_00126726 predicted 291
5 SASI_Hs01_00126727 predicted 316
6 SASI_Hs01_00126728 predicted 199
7 SASI_Hs01_00126729 predicted 221
8 SASI_Hs01_00126730 predicted 329
9 SASI_Hs01_00126731 predicted 202
10 SASI_Hs01_00126733 predicted 375
11 SASI_Hs01_00126732 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341700 predicted 356
2 SASI_Rn02_00341701 predicted 416
3 SASI_Rn02_00341702 predicted 323
4 SASI_Rn02_00341703 predicted 247
5 SASI_Rn02_00341704 predicted 444
6 SASI_Rn02_00341705 predicted 217
7 SASI_Rn02_00341706 predicted 364
8 SASI_Rn02_00341707 predicted 247
9 SASI_Rn02_00341708 predicted 216
10 SASI_Rn02_00341709 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109902 predicted 373
2 SASI_Mm01_00109903 predicted 850
3 SASI_Mm01_00109904 predicted 812
4 SASI_Mm01_00109905 predicted 793
5 SASI_Mm01_00109906 predicted 467
6 SASI_Mm01_00109907 predicted 421
7 SASI_Mm01_00109908 predicted 315
8 SASI_Mm01_00109910 predicted 569
9 SASI_Mm01_00109911 predicted 677
10 SASI_Mm02_00343644 predicted 440
11 SASI_Mm01_00109909 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181449
CD300E MISSION shRNA Bacterial Glycerol Stock
CD300e molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-179s21c1
Sequence:CCGGCAAGTACTGGTGCCGAGGACACTCGAGTGTCCTCGGCACCAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-601s21c1
Sequence:CCGGGCATGCTGGGTGCTGTCTTCTCTCGAGAGAAGACAGCACCCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-364s21c1
Sequence:CCGGCAGTGTGGGTCCTGGATTCATCTCGAGATGAATCCAGGACCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-336s1c1
Sequence:CCGGGCTGGATCTTACTGGTGCAAACTCGAGTTTGCACCAGTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-134s1c1
Sequence:CCGGTCTGACAGTGTGGTGTCAGTACTCGAGTACTGACACCACACTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-204s1c1
Sequence:CCGGGACACGTCATGTGAGAGCATTCTCGAGAATGCTCTCACATGACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-156s1c1
Sequence:CCGGGAGAGCATGTACAAGGGATATCTCGAGATATCCCTTGTACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-402s1c1
Sequence:CCGGGACCTGGTTAGGGTGTATGTTCTCGAGAACATACACCCTAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181449
CD300E MISSION shRNA shRNA Plasmid DNA
CD300e molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-179s21c1
Sequence:CCGGCAAGTACTGGTGCCGAGGACACTCGAGTGTCCTCGGCACCAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-601s21c1
Sequence:CCGGGCATGCTGGGTGCTGTCTTCTCTCGAGAGAAGACAGCACCCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-364s21c1
Sequence:CCGGCAGTGTGGGTCCTGGATTCATCTCGAGATGAATCCAGGACCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-336s1c1
Sequence:CCGGGCTGGATCTTACTGGTGCAAACTCGAGTTTGCACCAGTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-134s1c1
Sequence:CCGGTCTGACAGTGTGGTGTCAGTACTCGAGTACTGACACCACACTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-204s1c1
Sequence:CCGGGACACGTCATGTGAGAGCATTCTCGAGAATGCTCTCACATGACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-156s1c1
Sequence:CCGGGAGAGCATGTACAAGGGATATCTCGAGATATCCCTTGTACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-402s1c1
Sequence:CCGGGACCTGGTTAGGGTGTATGTTCTCGAGAACATACACCCTAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181449
CD300E MISSION shRNA Lentiviral Transduction Particles
CD300e molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-179s21c1
Sequence:CCGGCAAGTACTGGTGCCGAGGACACTCGAGTGTCCTCGGCACCAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-601s21c1
Sequence:CCGGGCATGCTGGGTGCTGTCTTCTCTCGAGAGAAGACAGCACCCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181449.1-364s21c1
Sequence:CCGGCAGTGTGGGTCCTGGATTCATCTCGAGATGAATCCAGGACCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-336s1c1
Sequence:CCGGGCTGGATCTTACTGGTGCAAACTCGAGTTTGCACCAGTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-134s1c1
Sequence:CCGGTCTGACAGTGTGGTGTCAGTACTCGAGTACTGACACCACACTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-204s1c1
Sequence:CCGGGACACGTCATGTGAGAGCATTCTCGAGAATGCTCTCACATGACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-156s1c1
Sequence:CCGGGAGAGCATGTACAAGGGATATCTCGAGATATCCCTTGTACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181449.1-402s1c1
Sequence:CCGGGACCTGGTTAGGGTGTATGTTCTCGAGAACATACACCCTAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172050
CD300E MISSION shRNA Bacterial Glycerol Stock
CD300e molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-167s1c1
Sequence:CCGGTCCATCATATAAGGGCTATATCTCGAGATATAGCCCTTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-361s1c1
Sequence:CCGGGCAAGATTCAGACTTCCTTTACTCGAGTAAAGGAAGTCTGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172050.1-1364s1c1
Sequence:CCGGGCAGAATAAATGTTTAGGGTTCTCGAGAACCCTAAACATTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-241s1c1
Sequence:CCGGCCGACGGAAGTGAGAAAGAAACTCGAGTTTCTTTCTCACTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-155s1c1
Sequence:CCGGGTGTCAATATAGTCCATCATACTCGAGTATGATGGACTATATTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172050
CD300E MISSION shRNA shRNA Plasmid DNA
CD300e molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-167s1c1
Sequence:CCGGTCCATCATATAAGGGCTATATCTCGAGATATAGCCCTTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-361s1c1
Sequence:CCGGGCAAGATTCAGACTTCCTTTACTCGAGTAAAGGAAGTCTGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172050.1-1364s1c1
Sequence:CCGGGCAGAATAAATGTTTAGGGTTCTCGAGAACCCTAAACATTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-241s1c1
Sequence:CCGGCCGACGGAAGTGAGAAAGAAACTCGAGTTTCTTTCTCACTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-155s1c1
Sequence:CCGGGTGTCAATATAGTCCATCATACTCGAGTATGATGGACTATATTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172050
CD300E MISSION shRNA Lentiviral Transduction Particles
CD300e molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-167s1c1
Sequence:CCGGTCCATCATATAAGGGCTATATCTCGAGATATAGCCCTTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-361s1c1
Sequence:CCGGGCAAGATTCAGACTTCCTTTACTCGAGTAAAGGAAGTCTGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172050.1-1364s1c1
Sequence:CCGGGCAGAATAAATGTTTAGGGTTCTCGAGAACCCTAAACATTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-241s1c1
Sequence:CCGGCCGACGGAAGTGAGAAAGAAACTCGAGTTTCTTTCTCACTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172050.1-155s1c1
Sequence:CCGGGTGTCAATATAGTCCATCATACTCGAGTATGATGGACTATATTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks