EMAIL THIS PAGE TO A FRIEND

CD300LB

CD300 molecule-like family member b

53 Gene Product Result for
Synonyms: CD300b CLM-7 CLM7 CMRF35-A2 IREM-3 IREM3 TREM-5 TREM5
UniProtKB ID: A8K4G0, Q1EG73, Q8IX40, Q8N6D1
Gene ID:
Human(124599) Summary: CD300LB is a nonclassical activating receptor of the immunoglobulin (Ig) superfamily expressed on myeloid cells (Martinez-Barriocanal and Sayos, 2006 [PubMed 16920917]
Mouse(217304) CD300 antigen like family member B
Rat(503490) Cd300 molecule-like family member B
cow(789755) CD300 molecule-like family member b
domestic cat(101088964) CD300 molecule-like family member b
sheep(101105174) CD300 molecule-like family member b
domestic guinea pig(100723898) CD300 molecule-like family member b
naked mole-rat(101715659) CD300 molecule-like family member b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302202 ANTI-CD300LB (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174892 Rosetta Predictions human pricing
XM_579047 Rosetta Predictions rat pricing
NM_199221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217452 predicted 402
2 SASI_Hs01_00217453 predicted 551
3 SASI_Hs01_00217454 predicted 453
4 SASI_Hs01_00217455 predicted 407
5 SASI_Hs01_00217456 predicted 214
6 SASI_Hs02_00368769 predicted 292
7 SASI_Hs01_00217457 predicted 676
8 SASI_Hs01_00217459 predicted 278
9 SASI_Hs01_00217460 predicted 243
10 SASI_Hs01_00217461 predicted 704
11 SASI_Hs01_00217458 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408546 predicted 81
2 SASI_Rn02_00408547 predicted 187
3 SASI_Rn02_00408548 predicted 142
4 SASI_Rn02_00408549 predicted 46
5 SASI_Rn02_00408550 predicted 216
6 SASI_Rn02_00408551 predicted 114
7 SASI_Rn02_00408552 predicted 127
8 SASI_Rn02_00408553 predicted 46
9 SASI_Rn02_00408554 predicted 211
10 SASI_Rn02_00408555 predicted 39
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055996 predicted 723
2 SASI_Mm01_00055997 predicted 758
3 SASI_Mm01_00055998 predicted 824
4 SASI_Mm01_00055999 predicted 925
5 SASI_Mm01_00056000 predicted 739
6 SASI_Mm01_00056001 predicted 732
7 SASI_Mm01_00056002 predicted 437
8 SASI_Mm01_00056003 predicted 515
9 SASI_Mm01_00056004 predicted 236
10 SASI_Mm01_00056005 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174892
CD300LB MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member b
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-414s1c1
Sequence:CCGGGATGTTTACTGGTGTGGGATTCTCGAGAATCCCACACCAGTAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1095s1c1
Sequence:CCGGGACCAACTCAACACCGTCTTTCTCGAGAAAGACGGTGTTGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-520s1c1
Sequence:CCGGCCAACAGCAATATGGCAGTGTCTCGAGACACTGCCATATTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-36s1c1
Sequence:CCGGCAGAACTTCCAGAGTGCATCTCTCGAGAGATGCACTCTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-511s1c1
Sequence:CCGGGCTCACCTACCAACAGCAATACTCGAGTATTGCTGTTGGTAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1644s1c1
Sequence:CCGGGCCCTTGAATGTGGTCACTTTCTCGAGAAAGTGACCACATTCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-524s1c1
Sequence:CCGGCAGCAATATGGCAGTGTTCATCTCGAGATGAACACTGCCATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1906s1c1
Sequence:CCGGCCTTCAGCCAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-701s1c1
Sequence:CCGGGACTAAAGACATGGCCACTTACTCGAGTAAGTGGCCATGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-282s1c1
Sequence:CCGGGATACATGCAAGATCCTCATTCTCGAGAATGAGGATCTTGCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1559s1c1
Sequence:CCGGCGGTGATGTTGAAATCATGTTCTCGAGAACATGATTTCAACATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174892
CD300LB MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member b
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-414s1c1
Sequence:CCGGGATGTTTACTGGTGTGGGATTCTCGAGAATCCCACACCAGTAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1095s1c1
Sequence:CCGGGACCAACTCAACACCGTCTTTCTCGAGAAAGACGGTGTTGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-520s1c1
Sequence:CCGGCCAACAGCAATATGGCAGTGTCTCGAGACACTGCCATATTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-36s1c1
Sequence:CCGGCAGAACTTCCAGAGTGCATCTCTCGAGAGATGCACTCTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-511s1c1
Sequence:CCGGGCTCACCTACCAACAGCAATACTCGAGTATTGCTGTTGGTAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1644s1c1
Sequence:CCGGGCCCTTGAATGTGGTCACTTTCTCGAGAAAGTGACCACATTCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-524s1c1
Sequence:CCGGCAGCAATATGGCAGTGTTCATCTCGAGATGAACACTGCCATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1906s1c1
Sequence:CCGGCCTTCAGCCAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-701s1c1
Sequence:CCGGGACTAAAGACATGGCCACTTACTCGAGTAAGTGGCCATGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-282s1c1
Sequence:CCGGGATACATGCAAGATCCTCATTCTCGAGAATGAGGATCTTGCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1559s1c1
Sequence:CCGGCGGTGATGTTGAAATCATGTTCTCGAGAACATGATTTCAACATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174892
CD300LB MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member b
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-414s1c1
Sequence:CCGGGATGTTTACTGGTGTGGGATTCTCGAGAATCCCACACCAGTAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1095s1c1
Sequence:CCGGGACCAACTCAACACCGTCTTTCTCGAGAAAGACGGTGTTGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-520s1c1
Sequence:CCGGCCAACAGCAATATGGCAGTGTCTCGAGACACTGCCATATTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-36s1c1
Sequence:CCGGCAGAACTTCCAGAGTGCATCTCTCGAGAGATGCACTCTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174892.1-511s1c1
Sequence:CCGGGCTCACCTACCAACAGCAATACTCGAGTATTGCTGTTGGTAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1644s1c1
Sequence:CCGGGCCCTTGAATGTGGTCACTTTCTCGAGAAAGTGACCACATTCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-524s1c1
Sequence:CCGGCAGCAATATGGCAGTGTTCATCTCGAGATGAACACTGCCATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174892.1-1906s1c1
Sequence:CCGGCCTTCAGCCAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-701s1c1
Sequence:CCGGGACTAAAGACATGGCCACTTACTCGAGTAAGTGGCCATGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174892.1-282s1c1
Sequence:CCGGGATACATGCAAGATCCTCATTCTCGAGAATGAGGATCTTGCATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174892.1-1559s1c1
Sequence:CCGGCGGTGATGTTGAAATCATGTTCTCGAGAACATGATTTCAACATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199221
CD300LB MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-425s1c1
Sequence:CCGGGCAGTACAGACATGGTGTCTTCTCGAGAAGACACCATGTCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-191s1c1
Sequence:CCGGCCACTGGGTCAGAGAAAGAAACTCGAGTTTCTTTCTCTGACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-298s1c1
Sequence:CCGGGACACTTACTGGTGTGGTATTCTCGAGAATACCACACCAGTAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-450s1c1
Sequence:CCGGCTTGCAGAAGAGGACCTATTACTCGAGTAATAGGTCCTCTTCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-344s1c1
Sequence:CCGGCCAGAGTTAAAGTGAACGTCTCTCGAGAGACGTTCACTTTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199221
CD300LB MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-425s1c1
Sequence:CCGGGCAGTACAGACATGGTGTCTTCTCGAGAAGACACCATGTCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-191s1c1
Sequence:CCGGCCACTGGGTCAGAGAAAGAAACTCGAGTTTCTTTCTCTGACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-298s1c1
Sequence:CCGGGACACTTACTGGTGTGGTATTCTCGAGAATACCACACCAGTAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-450s1c1
Sequence:CCGGCTTGCAGAAGAGGACCTATTACTCGAGTAATAGGTCCTCTTCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-344s1c1
Sequence:CCGGCCAGAGTTAAAGTGAACGTCTCTCGAGAGACGTTCACTTTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199221
CD300LB MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-425s1c1
Sequence:CCGGGCAGTACAGACATGGTGTCTTCTCGAGAAGACACCATGTCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-191s1c1
Sequence:CCGGCCACTGGGTCAGAGAAAGAAACTCGAGTTTCTTTCTCTGACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-298s1c1
Sequence:CCGGGACACTTACTGGTGTGGTATTCTCGAGAATACCACACCAGTAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-450s1c1
Sequence:CCGGCTTGCAGAAGAGGACCTATTACTCGAGTAATAGGTCCTCTTCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199221.1-344s1c1
Sequence:CCGGCCAGAGTTAAAGTGAACGTCTCTCGAGAGACGTTCACTTTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks