EMAIL THIS PAGE TO A FRIEND

CD300LD

CD300 molecule-like family member d

27 Gene Product Result for
Synonyms: CD300D CLM-4 CMRF35-A4 CMRF35A4
UniProtKB ID: Q6UXZ3
Gene ID:
Mouse(217305) CD300 molecule-like family member d
Rat(100361633) Cd300 molecule-like family member D
domestic guinea pig(101789044) CD300 molecule-like family member d
dog(100686711) CD300 molecule-like family member d
dog(100685972) CD300 molecule-like family member d
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001115152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001115152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001115152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115152 Rosetta Predictions human pricing
NM_145437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326976 predicted 410
2 SASI_Hs02_00326977 predicted 229
3 SASI_Hs02_00326978 predicted 391
4 SASI_Hs02_00326979 predicted 321
5 SASI_Hs02_00326980 predicted 281
6 SASI_Hs02_00326981 predicted 330
7 SASI_Hs02_00326982 predicted 407
8 SASI_Hs02_00326983 predicted 233
9 SASI_Hs02_00326984 predicted 397
10 SASI_Hs02_00326985 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073248 predicted 515
2 SASI_Mm01_00073249 predicted 249
3 SASI_Mm01_00073250 predicted 506
4 SASI_Mm01_00073251 predicted 244
5 SASI_Mm01_00073252 predicted 197
6 SASI_Mm01_00073253 predicted 199
7 SASI_Mm01_00073254 predicted 488
8 SASI_Mm01_00073255 predicted 260
9 SASI_Mm01_00073256 predicted 1128
10 SASI_Mm01_00073257 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145437
CD300LD MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member d
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000100030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145437.1-1407s1c1
Sequence:CCGGGCCAGTTGATTGACCAAATATCTCGAGATATTTGGTCAATCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-190s1c1
Sequence:CCGGGCAGTGCAGATATTCCTCATACTCGAGTATGAGGAATATCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-251s1c1
Sequence:CCGGCAGAGATCATGTGATATTCTTCTCGAGAAGAATATCACATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-614s1c1
Sequence:CCGGCTGATGGTCTTTGTGGAGTTACTCGAGTAACTCCACAAAGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145437
CD300LD MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member d
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000100030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145437.1-1407s1c1
Sequence:CCGGGCCAGTTGATTGACCAAATATCTCGAGATATTTGGTCAATCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-190s1c1
Sequence:CCGGGCAGTGCAGATATTCCTCATACTCGAGTATGAGGAATATCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-251s1c1
Sequence:CCGGCAGAGATCATGTGATATTCTTCTCGAGAAGAATATCACATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-614s1c1
Sequence:CCGGCTGATGGTCTTTGTGGAGTTACTCGAGTAACTCCACAAAGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145437
CD300LD MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member d
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000100030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145437.1-1407s1c1
Sequence:CCGGGCCAGTTGATTGACCAAATATCTCGAGATATTTGGTCAATCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-190s1c1
Sequence:CCGGGCAGTGCAGATATTCCTCATACTCGAGTATGAGGAATATCTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-251s1c1
Sequence:CCGGCAGAGATCATGTGATATTCTTCTCGAGAAGAATATCACATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145437.1-614s1c1
Sequence:CCGGCTGATGGTCTTTGTGGAGTTACTCGAGTAACTCCACAAAGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001115152
CD300LD MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member d
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-324s21c1
Sequence:CCGGAGAGATGATGCTGACAGTTATCTCGAGATAACTGTCAGCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-248s21c1
Sequence:CCGGGGTAAAGAAGAATCGAGTTTCCTCGAGGAAACTCGATTCTTCTTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-383s21c1
Sequence:CCGGCAAAGTTCAAGTGACCATTAACTCGAGTTAATGGTCACTTGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-69s21c1
Sequence:CCGGGGTTACTCCATTGCCGCTAAACTCGAGTTTAGCGGCAATGGAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-188s21c1
Sequence:CCGGTCAAGGAGCTGATTGGAATTACTCGAGTAATTCCAATCAGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001115152
CD300LD MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member d
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-324s21c1
Sequence:CCGGAGAGATGATGCTGACAGTTATCTCGAGATAACTGTCAGCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-248s21c1
Sequence:CCGGGGTAAAGAAGAATCGAGTTTCCTCGAGGAAACTCGATTCTTCTTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-383s21c1
Sequence:CCGGCAAAGTTCAAGTGACCATTAACTCGAGTTAATGGTCACTTGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-69s21c1
Sequence:CCGGGGTTACTCCATTGCCGCTAAACTCGAGTTTAGCGGCAATGGAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-188s21c1
Sequence:CCGGTCAAGGAGCTGATTGGAATTACTCGAGTAATTCCAATCAGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001115152
CD300LD MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member d
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-324s21c1
Sequence:CCGGAGAGATGATGCTGACAGTTATCTCGAGATAACTGTCAGCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-248s21c1
Sequence:CCGGGGTAAAGAAGAATCGAGTTTCCTCGAGGAAACTCGATTCTTCTTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-383s21c1
Sequence:CCGGCAAAGTTCAAGTGACCATTAACTCGAGTTAATGGTCACTTGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-69s21c1
Sequence:CCGGGGTTACTCCATTGCCGCTAAACTCGAGTTTAGCGGCAATGGAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115152.1-188s21c1
Sequence:CCGGTCAAGGAGCTGATTGGAATTACTCGAGTAATTCCAATCAGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks