EMAIL THIS PAGE TO A FRIEND

CD300LF

CD300 molecule-like family member f

78 Gene Product Result for
Synonyms: CD300f CLM-1 CLM1 IREM-1 IREM1 IgSF13 NKIR
Gene ID:
Human(146722) Summary: CD300LF is an inhibitory receptor of the Ig superfamily expressed on myeloid cells. It mediates negative regulatory signals by recruiting SHP1 (PTPN6; MIM 176883) or SHIP (INPP5D; MIM 601582) (Sui et al., 2004 [PubMed 15184070]
Mouse(246746) CD300 antigen like family member F
Rat(287818) Cd300 molecule-like family member F
naked mole-rat(101696452) CD300 molecule-like family member f
chicken(101668726) CD300 molecule-like family member f
dog(483297) CD300 molecule-like family member f
cow(101905619) CD300 molecule-like family member f
cow(100138789) CD300 molecule-like family member f
domestic cat(101090726) CD300 molecule-like family member f
chicken(101751571) CD300 molecule-like family member f
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1331 Human CD300f ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139018 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139018 Rosetta Predictions human pricing
NM_001025111 Rosetta Predictions rat pricing
NM_145634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112144 predicted 928
2 SASI_Hs01_00112145 predicted 877
3 SASI_Hs01_00112146 predicted 280
4 SASI_Hs01_00112147 predicted 281
5 SASI_Hs01_00112148 predicted 269
6 SASI_Hs01_00112149 predicted 708
7 SASI_Hs01_00112150 predicted 202
8 SASI_Hs01_00112152 predicted 267
9 SASI_Hs01_00112153 predicted 280
10 SASI_Hs02_00364061 predicted 455
11 SASI_Hs01_00112151 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077961 predicted 1242
2 SASI_Rn02_00202999 predicted 1273
3 SASI_Rn02_00203000 predicted 1153
4 SASI_Rn01_00077963 predicted 772
5 SASI_Rn01_00077964 predicted 977
6 SASI_Rn01_00077965 predicted 1038
7 SASI_Rn01_00077966 predicted 1162
8 SASI_Rn01_00077967 predicted 783
9 SASI_Rn01_00077968 predicted 764
10 SASI_Rn02_00203001 predicted 860
11 SASI_Rn01_00077960 predicted 997
12 SASI_Rn01_00077962 predicted 1011
13 SASI_Rn01_00077969 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174621 predicted 951
2 SASI_Mm01_00174622 predicted 1087
3 SASI_Mm01_00174623 predicted 625
4 SASI_Mm01_00174624 predicted 712
5 SASI_Mm01_00174625 predicted 265
6 SASI_Mm01_00174626 predicted 753
7 SASI_Mm01_00174627 predicted 498
8 SASI_Mm01_00174628 predicted 917
9 SASI_Mm01_00174629 predicted 868
10 SASI_Mm01_00174630 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145634
CD300LF MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member f
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-412s21c1
Sequence:CCGGATGAGCGATGCTGGCATTTACCTCGAGGTAAATGCCAGCATCGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1437s21c1
Sequence:CCGGTTCATCCTCATACCCATAATCCTCGAGGATTATGGGTATGAGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1353s21c1
Sequence:CCGGCGTATCAACGATGACAATAATCTCGAGATTATTGTCATCGTTGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-222s21c1
Sequence:CCGGGACAGTGCAGTGCCGATATACCTCGAGGTATATCGGCACTGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1122s21c1
Sequence:CCGGGGCTTGGAGCATGGATCTTTACTCGAGTAAAGATCCATGCTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145634.1-961s1c1
Sequence:CCGGGCCTCTGTACCTGCTTCCTTACTCGAGTAAGGAAGCAGGTACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-799s1c1
Sequence:CCGGAGGAGCCTACTTATGGCAATACTCGAGTATTGCCATAAGTAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-447s1c1
Sequence:CCGGCCAGCAATCCAAGTACCCATTCTCGAGAATGGGTACTTGGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-555s1c1
Sequence:CCGGCTGACTAGCTACTACTCTGATCTCGAGATCAGAGTAGTAGCTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145634
CD300LF MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member f
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-412s21c1
Sequence:CCGGATGAGCGATGCTGGCATTTACCTCGAGGTAAATGCCAGCATCGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1437s21c1
Sequence:CCGGTTCATCCTCATACCCATAATCCTCGAGGATTATGGGTATGAGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1353s21c1
Sequence:CCGGCGTATCAACGATGACAATAATCTCGAGATTATTGTCATCGTTGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-222s21c1
Sequence:CCGGGACAGTGCAGTGCCGATATACCTCGAGGTATATCGGCACTGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1122s21c1
Sequence:CCGGGGCTTGGAGCATGGATCTTTACTCGAGTAAAGATCCATGCTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145634.1-961s1c1
Sequence:CCGGGCCTCTGTACCTGCTTCCTTACTCGAGTAAGGAAGCAGGTACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-799s1c1
Sequence:CCGGAGGAGCCTACTTATGGCAATACTCGAGTATTGCCATAAGTAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-447s1c1
Sequence:CCGGCCAGCAATCCAAGTACCCATTCTCGAGAATGGGTACTTGGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-555s1c1
Sequence:CCGGCTGACTAGCTACTACTCTGATCTCGAGATCAGAGTAGTAGCTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145634
CD300LF MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member f
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-412s21c1
Sequence:CCGGATGAGCGATGCTGGCATTTACCTCGAGGTAAATGCCAGCATCGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1437s21c1
Sequence:CCGGTTCATCCTCATACCCATAATCCTCGAGGATTATGGGTATGAGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1353s21c1
Sequence:CCGGCGTATCAACGATGACAATAATCTCGAGATTATTGTCATCGTTGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145634.3-222s21c1
Sequence:CCGGGACAGTGCAGTGCCGATATACCTCGAGGTATATCGGCACTGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145634.3-1122s21c1
Sequence:CCGGGGCTTGGAGCATGGATCTTTACTCGAGTAAAGATCCATGCTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145634.1-961s1c1
Sequence:CCGGGCCTCTGTACCTGCTTCCTTACTCGAGTAAGGAAGCAGGTACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-799s1c1
Sequence:CCGGAGGAGCCTACTTATGGCAATACTCGAGTATTGCCATAAGTAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-447s1c1
Sequence:CCGGCCAGCAATCCAAGTACCCATTCTCGAGAATGGGTACTTGGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145634.1-555s1c1
Sequence:CCGGCTGACTAGCTACTACTCTGATCTCGAGATCAGAGTAGTAGCTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139018
CD300LF MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member f
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1278s21c1
Sequence:CCGGTGAAGTACCATTATCGTAATACTCGAGTATTACGATAATGGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139018.3-280s21c1
Sequence:CCGGGCGTGACTGCAAGATCCTTGTCTCGAGACAAGGATCTTGCAGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1440s21c1
Sequence:CCGGCTTTGAGATAGAGAGGTTATTCTCGAGAATAACCTCTCTATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-213s1c1
Sequence:CCGGCCGTGCAGTGTGTTTACAGATCTCGAGATCTGTAAACACACTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-640s1c1
Sequence:CCGGGATGATGAAGTACCAGCAGAACTCGAGTTCTGCTGGTACTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-412s1c1
Sequence:CCGGTGACACTTACTGGTGTGGAATCTCGAGATTCCACACCAGTAAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-825s1c1
Sequence:CCGGCCTTGCCGAAGGAGGACATTTCTCGAGAAATGTCCTCCTTCGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139018
CD300LF MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member f
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1278s21c1
Sequence:CCGGTGAAGTACCATTATCGTAATACTCGAGTATTACGATAATGGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139018.3-280s21c1
Sequence:CCGGGCGTGACTGCAAGATCCTTGTCTCGAGACAAGGATCTTGCAGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1440s21c1
Sequence:CCGGCTTTGAGATAGAGAGGTTATTCTCGAGAATAACCTCTCTATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-213s1c1
Sequence:CCGGCCGTGCAGTGTGTTTACAGATCTCGAGATCTGTAAACACACTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-640s1c1
Sequence:CCGGGATGATGAAGTACCAGCAGAACTCGAGTTCTGCTGGTACTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-412s1c1
Sequence:CCGGTGACACTTACTGGTGTGGAATCTCGAGATTCCACACCAGTAAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-825s1c1
Sequence:CCGGCCTTGCCGAAGGAGGACATTTCTCGAGAAATGTCCTCCTTCGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139018
CD300LF MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member f
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1278s21c1
Sequence:CCGGTGAAGTACCATTATCGTAATACTCGAGTATTACGATAATGGTACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139018.3-280s21c1
Sequence:CCGGGCGTGACTGCAAGATCCTTGTCTCGAGACAAGGATCTTGCAGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139018.3-1440s21c1
Sequence:CCGGCTTTGAGATAGAGAGGTTATTCTCGAGAATAACCTCTCTATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-213s1c1
Sequence:CCGGCCGTGCAGTGTGTTTACAGATCTCGAGATCTGTAAACACACTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-640s1c1
Sequence:CCGGGATGATGAAGTACCAGCAGAACTCGAGTTCTGCTGGTACTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-412s1c1
Sequence:CCGGTGACACTTACTGGTGTGGAATCTCGAGATTCCACACCAGTAAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139018.2-825s1c1
Sequence:CCGGCCTTGCCGAAGGAGGACATTTCTCGAGAAATGTCCTCCTTCGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks