EMAIL THIS PAGE TO A FRIEND

CD300LG

CD300 molecule-like family member g

53 Gene Product Result for
Synonyms: CLM-9 CLM9 NEPMUCIN TREM-4 TREM4
Gene ID:
Human(146894) Summary: Members of the CD300 (see MIM 606786)-like (CD300L) family, such as CD300LG, are widely expressed on hematopoietic cells. All CD300L proteins are type I cell surface glycoproteins that contain a single immunoglobulin (Ig) V-like domain (Takatsu et al., 2006 [PubMed 16876123]
Mouse(52685) CD300 antigen like family member G
Rat(684984) Cd300 molecule-like family member G
dog(607203) CD300 molecule-like family member g
cow(615388) CD300 molecule-like family member g
domestic cat(101084243) CD300 molecule-like family member g
naked mole-rat(101699517) CD300 molecule-like family member g
domestic guinea pig(100730164) CD300 molecule-like family member g
sheep(101114629) CD300 molecule-like family member g
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145273 Rosetta Predictions human pricing
XM_001061779 Rosetta Predictions rat pricing
NM_027987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365146 predicted 917
2 SASI_Hs01_00105315 predicted 299
3 SASI_Hs01_00105316 predicted 608
4 SASI_Hs01_00105317 predicted 1012
5 SASI_Hs01_00105318 predicted 881
6 SASI_Hs01_00105319 predicted 1094
7 SASI_Hs02_00365147 predicted 614
8 SASI_Hs01_00105320 predicted 394
9 SASI_Hs01_00105321 predicted 1263
10 SASI_Hs01_00105322 predicted 1193
11 SASI_Hs01_00105323 predicted 740
12 SASI_Hs01_00105324 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301325 predicted 304
2 SASI_Rn02_00301326 predicted 197
3 SASI_Rn02_00301327 predicted 292
4 SASI_Rn02_00301328 predicted 233
5 SASI_Rn02_00301329 predicted 301
6 SASI_Rn02_00301330 predicted 288
7 SASI_Rn02_00301331 predicted 266
8 SASI_Rn02_00301332 predicted 282
9 SASI_Rn02_00301333 predicted 235
10 SASI_Rn02_00301334 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123915 predicted 309
2 SASI_Mm01_00123916 predicted 686
3 SASI_Mm01_00123917 predicted 296
4 SASI_Mm02_00333048 predicted 321
5 SASI_Mm01_00123918 predicted 224
6 SASI_Mm01_00123919 predicted 767
7 SASI_Mm01_00123920 predicted 328
8 SASI_Mm01_00123921 predicted 342
9 SASI_Mm01_00123922 predicted 552
10 SASI_Mm01_00123923 predicted 1085
11 SASI_Mm01_00123924 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145273
CD300LG MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member g
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-104s1c1
Sequence:CCGGCCCAGAGGAAATCAGCGGGTTCTCGAGAACCCGCTGATTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-382s1c1
Sequence:CCGGCCGATGAGTCTTTACTGATCTCTCGAGAGATCAGTAAAGACTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-858s1c1
Sequence:CCGGCTGTGGAGAAAGGAAGCTCAACTCGAGTTGAGCTTCCTTTCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-1009s21c1
Sequence:CCGGAGCTGGGCTTCTCGAAGTTTGCTCGAGCAAACTTCGAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1092s21c1
Sequence:CCGGATCAGCACCGATTCCCGAAAGCTCGAGCTTTCGGGAATCGGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1339s21c1
Sequence:CCGGAGTGGATCTGGTCTGAGTTTCCTCGAGGAAACTCAGACCAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-397s21c1
Sequence:CCGGTGATCTCTCTGTTCGTCTTTCCTCGAGGAAAGACGAACAGAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-889s21c1
Sequence:CCGGAGACACAGAGGAACGAGAAGTCTCGAGACTTCTCGTTCCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-246s21c1
Sequence:CCGGGAAGAAGGCCAGGAGACAATGCTCGAGCATTGTCTCCTGGCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145273
CD300LG MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member g
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-104s1c1
Sequence:CCGGCCCAGAGGAAATCAGCGGGTTCTCGAGAACCCGCTGATTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-382s1c1
Sequence:CCGGCCGATGAGTCTTTACTGATCTCTCGAGAGATCAGTAAAGACTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-858s1c1
Sequence:CCGGCTGTGGAGAAAGGAAGCTCAACTCGAGTTGAGCTTCCTTTCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-1009s21c1
Sequence:CCGGAGCTGGGCTTCTCGAAGTTTGCTCGAGCAAACTTCGAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1092s21c1
Sequence:CCGGATCAGCACCGATTCCCGAAAGCTCGAGCTTTCGGGAATCGGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1339s21c1
Sequence:CCGGAGTGGATCTGGTCTGAGTTTCCTCGAGGAAACTCAGACCAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-397s21c1
Sequence:CCGGTGATCTCTCTGTTCGTCTTTCCTCGAGGAAAGACGAACAGAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-889s21c1
Sequence:CCGGAGACACAGAGGAACGAGAAGTCTCGAGACTTCTCGTTCCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-246s21c1
Sequence:CCGGGAAGAAGGCCAGGAGACAATGCTCGAGCATTGTCTCCTGGCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145273
CD300LG MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member g
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-104s1c1
Sequence:CCGGCCCAGAGGAAATCAGCGGGTTCTCGAGAACCCGCTGATTTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-382s1c1
Sequence:CCGGCCGATGAGTCTTTACTGATCTCTCGAGAGATCAGTAAAGACTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145273.2-858s1c1
Sequence:CCGGCTGTGGAGAAAGGAAGCTCAACTCGAGTTGAGCTTCCTTTCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-1009s21c1
Sequence:CCGGAGCTGGGCTTCTCGAAGTTTGCTCGAGCAAACTTCGAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1092s21c1
Sequence:CCGGATCAGCACCGATTCCCGAAAGCTCGAGCTTTCGGGAATCGGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145273.2-1339s21c1
Sequence:CCGGAGTGGATCTGGTCTGAGTTTCCTCGAGGAAACTCAGACCAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-397s21c1
Sequence:CCGGTGATCTCTCTGTTCGTCTTTCCTCGAGGAAAGACGAACAGAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-889s21c1
Sequence:CCGGAGACACAGAGGAACGAGAAGTCTCGAGACTTCTCGTTCCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145273.2-246s21c1
Sequence:CCGGGAAGAAGGCCAGGAGACAATGCTCGAGCATTGTCTCCTGGCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027987
CD300LG MISSION shRNA Bacterial Glycerol Stock
CD300 molecule-like family member g
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000100010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027987.1-1272s1c1
Sequence:CCGGCCTCTAATTCTTCTGCATCAACTCGAGTTGATGCAGAAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-225s1c1
Sequence:CCGGGCGGTGACATTGTCTACGCAACTCGAGTTGCGTAGACAATGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-148s1c1
Sequence:CCGGGCGGTGTACCTACGTGGAGAACTCGAGTTCTCCACGTAGGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-563s1c1
Sequence:CCGGGCTGCAGGACTAATTGCCTTTCTCGAGAAAGGCAATTAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027987
CD300LG MISSION shRNA shRNA Plasmid DNA
CD300 molecule-like family member g
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000100010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027987.1-1272s1c1
Sequence:CCGGCCTCTAATTCTTCTGCATCAACTCGAGTTGATGCAGAAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-225s1c1
Sequence:CCGGGCGGTGACATTGTCTACGCAACTCGAGTTGCGTAGACAATGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-148s1c1
Sequence:CCGGGCGGTGTACCTACGTGGAGAACTCGAGTTCTCCACGTAGGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-563s1c1
Sequence:CCGGGCTGCAGGACTAATTGCCTTTCTCGAGAAAGGCAATTAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027987
CD300LG MISSION shRNA Lentiviral Transduction Particles
CD300 molecule-like family member g
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000100010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027987.1-1272s1c1
Sequence:CCGGCCTCTAATTCTTCTGCATCAACTCGAGTTGATGCAGAAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-225s1c1
Sequence:CCGGGCGGTGACATTGTCTACGCAACTCGAGTTGCGTAGACAATGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-148s1c1
Sequence:CCGGGCGGTGTACCTACGTGGAGAACTCGAGTTCTCCACGTAGGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027987.1-563s1c1
Sequence:CCGGGCTGCAGGACTAATTGCCTTTCTCGAGAAAGGCAATTAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks