EMAIL THIS PAGE TO A FRIEND

CD302

CD302 molecule

54 Gene Product Result for
Synonyms: BIMLEC CLEC13A DCL-1 DCL1
UniProtKB ID: Q8IX05, A8K5G4, B4E2T9, Q15009
Gene ID:
Human(9936) Summary: CD302 is a C-type lectin receptor involved in cell adhesion and migration, as well as endocytosis and phagocytosis (Kato et al., 2007 [PubMed 17947679]
Mouse(66205) CD302 antigen
Rat(295629) CD302 molecule
sheep(101110210) CD302 molecule
cow(100126272) CD302 molecule
dog(100126287) CD302 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503738 Anti-CD302 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300754 Anti-CD302 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB1303077 ANTI-DCL-1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014880 Rosetta Predictions human pricing
NM_001013916 Rosetta Predictions rat pricing
NM_025422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038343 predicted 724
2 SASI_Hs01_00038344 predicted 560
3 SASI_Hs01_00038345 predicted 599
4 SASI_Hs01_00038346 predicted 336
5 SASI_Hs01_00038347 predicted 817
6 SASI_Hs01_00038348 predicted 670
7 SASI_Hs02_00346497 predicted 341
8 SASI_Hs02_00346498 predicted 767
9 SASI_Hs01_00038350 predicted 746
10 SASI_Hs01_00038351 predicted 833
11 SASI_Hs01_00038349 predicted 627
12 SASI_Hs01_00038352 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035715 predicted 696
2 SASI_Rn01_00035716 predicted 898
3 SASI_Rn01_00035717 predicted 595
4 SASI_Rn01_00035718 predicted 526
5 SASI_Rn01_00035719 predicted 783
6 SASI_Rn01_00035720 predicted 928
7 SASI_Rn01_00035721 predicted 974
8 SASI_Rn01_00035722 predicted 533
9 SASI_Rn02_00201203 predicted 282
10 SASI_Rn01_00035724 predicted 375
11 SASI_Rn01_00035723 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046993 predicted 574
2 SASI_Mm01_00046994 predicted 471
3 SASI_Mm01_00046995 predicted 625
4 SASI_Mm02_00328217 predicted 881
5 SASI_Mm01_00046996 predicted 647
6 SASI_Mm01_00046997 predicted 734
7 SASI_Mm02_00328218 predicted 734
8 SASI_Mm01_00046999 predicted 582
9 SASI_Mm01_00047000 predicted 589
10 SASI_Mm01_00047001 predicted 626
11 SASI_Mm01_00046998 predicted 383
12 SASI_Mm01_00047002 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025422
VALIDATED
CD302 MISSION shRNA Bacterial Glycerol Stock
CD302 molecule
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-478s1c1
Sequence:CCGGGACATGGTAAGCATACACAATCTCGAGATTGTGTATGCTTACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-589s1c1
Sequence:CCGGGATGCAACTTTCAAGTGGTATCTCGAGATACCACTTGAAAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-750s1c1
Sequence:CCGGCAAAGCAGCAAATAACCACATCTCGAGATGTGGTTATTTGCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-925s1c1
Sequence:CCGGGCAGAAGAAGATGAATATGCTCTCGAGAGCATATTCATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-592s1c1
Sequence:CCGGGCAACTTTCAAGTGGTATGATCTCGAGATCATACCACTTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-919s1c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-982s1c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-660s1c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-993s1c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-658s21c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-991s21c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-980s21c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-917s21c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025422
VALIDATED
CD302 MISSION shRNA shRNA Plasmid DNA
CD302 molecule
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-478s1c1
Sequence:CCGGGACATGGTAAGCATACACAATCTCGAGATTGTGTATGCTTACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-589s1c1
Sequence:CCGGGATGCAACTTTCAAGTGGTATCTCGAGATACCACTTGAAAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-750s1c1
Sequence:CCGGCAAAGCAGCAAATAACCACATCTCGAGATGTGGTTATTTGCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-925s1c1
Sequence:CCGGGCAGAAGAAGATGAATATGCTCTCGAGAGCATATTCATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-592s1c1
Sequence:CCGGGCAACTTTCAAGTGGTATGATCTCGAGATCATACCACTTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-919s1c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-982s1c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-660s1c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-993s1c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-658s21c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-991s21c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-980s21c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-917s21c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025422
VALIDATED
CD302 MISSION shRNA Lentiviral Transduction Particles
CD302 molecule
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-478s1c1
Sequence:CCGGGACATGGTAAGCATACACAATCTCGAGATTGTGTATGCTTACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-589s1c1
Sequence:CCGGGATGCAACTTTCAAGTGGTATCTCGAGATACCACTTGAAAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-750s1c1
Sequence:CCGGCAAAGCAGCAAATAACCACATCTCGAGATGTGGTTATTTGCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-925s1c1
Sequence:CCGGGCAGAAGAAGATGAATATGCTCTCGAGAGCATATTCATCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025422.1-592s1c1
Sequence:CCGGGCAACTTTCAAGTGGTATGATCTCGAGATCATACCACTTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-919s1c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-982s1c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-660s1c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025422.1-993s1c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-658s21c1
Sequence:CCGGCCTAGTTGATACCTGTGGTTTCTCGAGAAACCACAGGTATCAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-991s21c1
Sequence:CCGGCCATTGACAATAATTTCCTGTCTCGAGACAGGAAATTATTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025422.3-980s21c1
Sequence:CCGGGCATATTGAATCCATTGACAACTCGAGTTGTCAATGGATTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025422.3-917s21c1
Sequence:CCGGGTAGTTGCAGAAGAAGATGAACTCGAGTTCATCTTCTTCTGCAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014880
VALIDATED
CD302 MISSION shRNA Bacterial Glycerol Stock
CD302 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-226s1c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-339s1c1
Sequence:CCGGGATGCGAGTTTCAAGTGGTTTCTCGAGAAACCACTTGAAACTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-109s1c1
Sequence:CCGGCGGACTGTCCTTCATCTACTTCTCGAGAAGTAGATGAAGGACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-602s1c1
Sequence:CCGGAGCAATCATTTGGTTCCTGTACTCGAGTACAGGAACCAAATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-435s1c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-448s21c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-581s21c1
Sequence:CCGGTGATTGCTAGCACGGTAATTTCTCGAGAAATTACCGTGCTAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-239s21c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-864s21c1
Sequence:CCGGTTCCTTATTCCAGTAACATTTCTCGAGAAATGTTACTGGAATAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014880
VALIDATED
CD302 MISSION shRNA shRNA Plasmid DNA
CD302 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-226s1c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-339s1c1
Sequence:CCGGGATGCGAGTTTCAAGTGGTTTCTCGAGAAACCACTTGAAACTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-109s1c1
Sequence:CCGGCGGACTGTCCTTCATCTACTTCTCGAGAAGTAGATGAAGGACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-602s1c1
Sequence:CCGGAGCAATCATTTGGTTCCTGTACTCGAGTACAGGAACCAAATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-435s1c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-448s21c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-581s21c1
Sequence:CCGGTGATTGCTAGCACGGTAATTTCTCGAGAAATTACCGTGCTAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-239s21c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-864s21c1
Sequence:CCGGTTCCTTATTCCAGTAACATTTCTCGAGAAATGTTACTGGAATAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014880
VALIDATED
CD302 MISSION shRNA Lentiviral Transduction Particles
CD302 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-226s1c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-339s1c1
Sequence:CCGGGATGCGAGTTTCAAGTGGTTTCTCGAGAAACCACTTGAAACTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-109s1c1
Sequence:CCGGCGGACTGTCCTTCATCTACTTCTCGAGAAGTAGATGAAGGACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-602s1c1
Sequence:CCGGAGCAATCATTTGGTTCCTGTACTCGAGTACAGGAACCAAATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014880.3-435s1c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-448s21c1
Sequence:CCGGCTGCACATCAAGACAGGTGAACTCGAGTTCACCTGTCTTGATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014880.4-581s21c1
Sequence:CCGGTGATTGCTAGCACGGTAATTTCTCGAGAAATTACCGTGCTAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-239s21c1
Sequence:CCGGCGGACATGATAAGCATACATACTCGAGTATGTATGCTTATCATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014880.4-864s21c1
Sequence:CCGGTTCCTTATTCCAGTAACATTTCTCGAGAAATGTTACTGGAATAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks