EMAIL THIS PAGE TO A FRIEND

CD320

CD320 molecule

80 Gene Product Result for
Synonyms: 8D6 8D6A TCBLR
UniProtKB ID: Q9NPF0, B2RDS5, D6W668, F5H6D3, Q53HF7
Gene ID:
Human(51293) Summary: This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
Mouse(54219) CD320 antigen
Rat(362851) CD320 molecule
chicken(420066) CD320 molecule
domestic cat(101093668) CD320 molecule
cow(505043) CD320 molecule
dog(476721) CD320 molecule
sheep(101102807) CD320 molecule
naked mole-rat(101715897) CD320 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1333 Human CD320 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072951 MISSION® esiRNA esiRNA human CD320 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016579 Rosetta Predictions human pricing
NM_001014201 Rosetta Predictions rat pricing
XM_001067944 Rosetta Predictions rat pricing
NM_019421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349709 predicted 1012
2 SASI_Hs01_00170999 predicted 483
3 SASI_Hs01_00171000 predicted 341
4 SASI_Hs01_00171002 predicted 566
5 SASI_Hs01_00171003 predicted 964
6 SASI_Hs01_00171004 predicted 682
7 SASI_Hs01_00171005 predicted 317
8 SASI_Hs01_00171006 predicted 477
9 SASI_Hs01_00171007 predicted 706
10 SASI_Hs01_00171008 predicted 928
11 SASI_Hs01_00171001 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049466 predicted 255
2 SASI_Rn01_00049467 predicted 276
3 SASI_Rn01_00049469 predicted 476
4 SASI_Rn01_00049470 predicted 711
5 SASI_Rn01_00049471 predicted 572
6 SASI_Rn01_00049472 predicted 733
7 SASI_Rn01_00049473 predicted 535
8 SASI_Rn01_00049475 predicted 540
9 SASI_Rn02_00201724 predicted 721
10 SASI_Rn02_00201725 predicted 285
11 SASI_Rn01_00049468 predicted 609
12 SASI_Rn01_00049474 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322893 predicted 468
2 SASI_Rn02_00322894 predicted 329
3 SASI_Rn02_00322895 predicted 672
4 SASI_Rn02_00322896 predicted 575
5 SASI_Rn02_00322897 predicted 430
6 SASI_Rn02_00322898 predicted 596
7 SASI_Rn02_00322899 predicted 392
8 SASI_Rn02_00322900 predicted 381
9 SASI_Rn02_00322901 predicted 394
10 SASI_Rn02_00322902 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129487 predicted 637
2 SASI_Mm01_00129488 predicted 1147
3 SASI_Mm01_00129489 predicted 233
4 SASI_Mm02_00324345 predicted 671
5 SASI_Mm01_00129490 predicted 316
6 SASI_Mm01_00129492 predicted 1149
7 SASI_Mm01_00129493 predicted 464
8 SASI_Mm01_00129494 predicted 524
9 SASI_Mm01_00129495 predicted 851
10 SASI_Mm01_00129496 predicted 645
11 SASI_Mm01_00129491 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019421
CD320 MISSION shRNA Bacterial Glycerol Stock
CD320 molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-857s21c1
Sequence:CCGGGATCTGAGGACACATGGTTACCTCGAGGTAACCATGTGTCCTCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-378s21c1
Sequence:CCGGCCTTGCTCCTGTGACAACATCCTCGAGGATGTTGTCACAGGAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-601s21c1
Sequence:CCGGCCACAACTACAAGGATTTCTACTCGAGTAGAAATCCTTGTAGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019421.3-1153s21c1
Sequence:CCGGCATTGATGGGTGGCTATTAAACTCGAGTTTAATAGCCACCCATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-561s21c1
Sequence:CCGGACTGACACAGAAATTGATAAGCTCGAGCTTATCAATTTCTGTGTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-241s21c1
Sequence:CCGGGTCTTACCAGTGGCTATTGTGCTCGAGCACAATAGCCACTGGTAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019421.2-972s1c1
Sequence:CCGGGAGCACAGAGAACTTTGATTTCTCGAGAAATCAAAGTTCTCTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-466s1c1
Sequence:CCGGCTGCATTGCATACTGGATGATCTCGAGATCATCCAGTATGCAATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-637s1c1
Sequence:CCGGGAGACCTCTTTCAGGAATGTACTCGAGTACATTCCTGAAAGAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-313s1c1
Sequence:CCGGGACGAGGAAGACTGTAGGATTCTCGAGAATCCTACAGTCTTCCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019421
CD320 MISSION shRNA shRNA Plasmid DNA
CD320 molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-857s21c1
Sequence:CCGGGATCTGAGGACACATGGTTACCTCGAGGTAACCATGTGTCCTCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-378s21c1
Sequence:CCGGCCTTGCTCCTGTGACAACATCCTCGAGGATGTTGTCACAGGAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-601s21c1
Sequence:CCGGCCACAACTACAAGGATTTCTACTCGAGTAGAAATCCTTGTAGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019421.3-1153s21c1
Sequence:CCGGCATTGATGGGTGGCTATTAAACTCGAGTTTAATAGCCACCCATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-561s21c1
Sequence:CCGGACTGACACAGAAATTGATAAGCTCGAGCTTATCAATTTCTGTGTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-241s21c1
Sequence:CCGGGTCTTACCAGTGGCTATTGTGCTCGAGCACAATAGCCACTGGTAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019421.2-972s1c1
Sequence:CCGGGAGCACAGAGAACTTTGATTTCTCGAGAAATCAAAGTTCTCTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-466s1c1
Sequence:CCGGCTGCATTGCATACTGGATGATCTCGAGATCATCCAGTATGCAATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-637s1c1
Sequence:CCGGGAGACCTCTTTCAGGAATGTACTCGAGTACATTCCTGAAAGAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-313s1c1
Sequence:CCGGGACGAGGAAGACTGTAGGATTCTCGAGAATCCTACAGTCTTCCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019421
CD320 MISSION shRNA Lentiviral Transduction Particles
CD320 molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-857s21c1
Sequence:CCGGGATCTGAGGACACATGGTTACCTCGAGGTAACCATGTGTCCTCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-378s21c1
Sequence:CCGGCCTTGCTCCTGTGACAACATCCTCGAGGATGTTGTCACAGGAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-601s21c1
Sequence:CCGGCCACAACTACAAGGATTTCTACTCGAGTAGAAATCCTTGTAGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019421.3-1153s21c1
Sequence:CCGGCATTGATGGGTGGCTATTAAACTCGAGTTTAATAGCCACCCATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-561s21c1
Sequence:CCGGACTGACACAGAAATTGATAAGCTCGAGCTTATCAATTTCTGTGTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019421.3-241s21c1
Sequence:CCGGGTCTTACCAGTGGCTATTGTGCTCGAGCACAATAGCCACTGGTAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019421.2-972s1c1
Sequence:CCGGGAGCACAGAGAACTTTGATTTCTCGAGAAATCAAAGTTCTCTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-466s1c1
Sequence:CCGGCTGCATTGCATACTGGATGATCTCGAGATCATCCAGTATGCAATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-637s1c1
Sequence:CCGGGAGACCTCTTTCAGGAATGTACTCGAGTACATTCCTGAAAGAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019421.2-313s1c1
Sequence:CCGGGACGAGGAAGACTGTAGGATTCTCGAGAATCCTACAGTCTTCCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016579
VALIDATED
CD320 MISSION shRNA Bacterial Glycerol Stock
CD320 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-424s21c1
Sequence:CCGGACTGACAAGAAACTGCGCAACCTCGAGGTTGCGCAGTTTCTTGTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-492s21c1
Sequence:CCGGCGATGACTGCATTCCACTCACCTCGAGGTGAGTGGAATGCAGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-855s21c1
Sequence:CCGGGTTACTGGTGGCCATGAAGGACTCGAGTCCTTCATGGCCACCAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-343s1c1
Sequence:CCGGCATGTACCCAGAAAGGGCAATCTCGAGATTGCCCTTTCTGGGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-570s1c1
Sequence:CCGGACCAATGAGATCCTCCCGGAACTCGAGTTCCGGGAGGATCTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-641s1c1
Sequence:CCGGTCTCAGGAATGCCACAACCATCTCGAGATGGTTGTGGCATTCCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-328s1c1
Sequence:CCGGAGTGCAGGATTGAGCCATGTACTCGAGTACATGGCTCAATCCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-1005s1c1
Sequence:CCGGCCCTCAGAGACCTGAGCTCTTCTCGAGAAGAGCTCAGGTCTCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016579
VALIDATED
CD320 MISSION shRNA shRNA Plasmid DNA
CD320 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-424s21c1
Sequence:CCGGACTGACAAGAAACTGCGCAACCTCGAGGTTGCGCAGTTTCTTGTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-492s21c1
Sequence:CCGGCGATGACTGCATTCCACTCACCTCGAGGTGAGTGGAATGCAGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-855s21c1
Sequence:CCGGGTTACTGGTGGCCATGAAGGACTCGAGTCCTTCATGGCCACCAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-343s1c1
Sequence:CCGGCATGTACCCAGAAAGGGCAATCTCGAGATTGCCCTTTCTGGGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-570s1c1
Sequence:CCGGACCAATGAGATCCTCCCGGAACTCGAGTTCCGGGAGGATCTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-641s1c1
Sequence:CCGGTCTCAGGAATGCCACAACCATCTCGAGATGGTTGTGGCATTCCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-328s1c1
Sequence:CCGGAGTGCAGGATTGAGCCATGTACTCGAGTACATGGCTCAATCCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-1005s1c1
Sequence:CCGGCCCTCAGAGACCTGAGCTCTTCTCGAGAAGAGCTCAGGTCTCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016579
VALIDATED
CD320 MISSION shRNA Lentiviral Transduction Particles
CD320 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-424s21c1
Sequence:CCGGACTGACAAGAAACTGCGCAACCTCGAGGTTGCGCAGTTTCTTGTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-492s21c1
Sequence:CCGGCGATGACTGCATTCCACTCACCTCGAGGTGAGTGGAATGCAGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016579.3-855s21c1
Sequence:CCGGGTTACTGGTGGCCATGAAGGACTCGAGTCCTTCATGGCCACCAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-343s1c1
Sequence:CCGGCATGTACCCAGAAAGGGCAATCTCGAGATTGCCCTTTCTGGGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-570s1c1
Sequence:CCGGACCAATGAGATCCTCCCGGAACTCGAGTTCCGGGAGGATCTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016579.2-641s1c1
Sequence:CCGGTCTCAGGAATGCCACAACCATCTCGAGATGGTTGTGGCATTCCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-328s1c1
Sequence:CCGGAGTGCAGGATTGAGCCATGTACTCGAGTACATGGCTCAATCCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016579.2-1005s1c1
Sequence:CCGGCCCTCAGAGACCTGAGCTCTTCTCGAGAAGAGCTCAGGTCTCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)