EMAIL THIS PAGE TO A FRIEND

CD33

CD33 molecule

82 Gene Product Result for
Synonyms: SIGLEC-3 SIGLEC3 p67
UniProtKB ID: P20138, B4E3P8, C9JEN7, F8WAL2, Q8TD24
Gene ID:
Mouse(12489) CD33 antigen
Rat(690492) CD33 molecule
sheep(101120859) CD33 molecule
domestic cat(101096432) CD33 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405586 Anti-CD33 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA035832 Anti-CD33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA064807 Anti-CD33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0000945M1 Monoclonal Anti-CD33 antibody produced in mouse clone 2D12-G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700152 Monoclonal Anti-CD33 antibody produced in mouse clone HIM3-4, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700737 Monoclonal Anti-CD33 antibody produced in mouse clone WM53, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, FUNC, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700718 Monoclonal Anti-CD33-APC antibody produced in mouse clone WM53, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry, FUNC, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700154 Monoclonal Anti-CD33-Biotin antibody produced in mouse clone HIM3-4, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700155 Monoclonal Anti-CD33-FITC antibody produced in mouse clone WM53, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082618 Rosetta Predictions human pricing
NM_001772 Rosetta Predictions human pricing
NM_001111058 Rosetta Predictions mouse pricing
NM_021293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316742 predicted 361
2 SASI_Hs02_00316743 predicted 665
3 SASI_Hs02_00316744 predicted 650
4 SASI_Hs02_00316745 predicted 362
5 SASI_Hs02_00316746 predicted 666
6 SASI_Hs02_00316747 predicted 383
7 SASI_Hs02_00316748 predicted 588
8 SASI_Hs02_00316749 predicted 348
9 SASI_Hs02_00316750 predicted 336
10 SASI_Hs02_00316751 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332515 predicted 747
2 SASI_Hs01_00137492 predicted 1051
3 SASI_Hs01_00137493 predicted 1038
4 SASI_Hs01_00137494 predicted 736
5 SASI_Hs01_00137496 predicted 1045
6 SASI_Hs02_00332516 predicted 769
7 SASI_Hs02_00332517 predicted 969
8 SASI_Hs02_00332518 predicted 728
9 SASI_Hs02_00332519 predicted 714
10 SASI_Hs02_00332520 predicted 938
11 SASI_Hs01_00137491 predicted 452
12 SASI_Hs01_00137495 predicted 591
13 SASI_Hs01_00137497 predicted 589
14 SASI_Hs01_00137498 predicted 343
15 SASI_Hs01_00137499 predicted 235
16 SASI_Hs01_00137500 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306245 predicted 1277
2 SASI_Mm02_00306246 predicted 1442
3 SASI_Mm02_00306247 predicted 1500
4 SASI_Mm02_00306248 predicted 1346
5 SASI_Mm02_00306249 predicted 1341
6 SASI_Mm02_00306250 predicted 1269
7 SASI_Mm02_00306251 predicted 366
8 SASI_Mm02_00306252 predicted 306
9 SASI_Mm02_00306253 predicted 1552
10 SASI_Mm02_00306254 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325823 predicted 1190
2 SASI_Mm02_00325824 predicted 1359
3 SASI_Mm02_00325825 predicted 1418
4 SASI_Mm02_00325826 predicted 1261
5 SASI_Mm02_00325827 predicted 1259
6 SASI_Mm02_00325828 predicted 1188
7 SASI_Mm01_00146516 predicted 365
8 SASI_Mm01_00146517 predicted 302
9 SASI_Mm02_00325829 predicted 1473
10 SASI_Mm02_00325830 predicted 1497
11 SASI_Mm01_00146514 predicted 701
12 SASI_Mm01_00146515 predicted 828
13 SASI_Mm01_00146518 predicted 955
14 SASI_Mm01_00146519 predicted 704
15 SASI_Mm01_00146520 predicted 863
16 SASI_Mm01_00146521 predicted 800
17 SASI_Mm01_00146522 predicted 1048
18 SASI_Mm01_00146523 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001772
CD33 MISSION shRNA Bacterial Glycerol Stock
CD33 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001772.2-1202s1c1
Sequence:CCGGGCAATGGGTTTATAGACATTACTCGAGTAATGTCTATAAACCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1023s1c1
Sequence:CCGGGCTGCATTATGCTTCCCTCAACTCGAGTTGAGGGAAGCATAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1038s1c1
Sequence:CCGGCCTCAACTTTCATGGGATGAACTCGAGTTCATCCCATGAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-840s1c1
Sequence:CCGGCCTCATCTTCTTCATAGTGAACTCGAGTTCACTATGAAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-232s1c1
Sequence:CCGGGCCACAAACAAGCTAGATCAACTCGAGTTGATCTAGCTTGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-80s21c1
Sequence:CCGGGCCCTGGCTATGGATCCAAATCTCGAGATTTGGATCCATAGCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001772.3-1263s21c1
Sequence:CCGGGCTATATTAACATCATCTTAGCTCGAGCTAAGATGATGTTAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-616s21c1
Sequence:CCGGTCACTCCTCGGTGCTCATAATCTCGAGATTATGAGCACCGAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001772
CD33 MISSION shRNA shRNA Plasmid DNA
CD33 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001772.2-1202s1c1
Sequence:CCGGGCAATGGGTTTATAGACATTACTCGAGTAATGTCTATAAACCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1023s1c1
Sequence:CCGGGCTGCATTATGCTTCCCTCAACTCGAGTTGAGGGAAGCATAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1038s1c1
Sequence:CCGGCCTCAACTTTCATGGGATGAACTCGAGTTCATCCCATGAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-840s1c1
Sequence:CCGGCCTCATCTTCTTCATAGTGAACTCGAGTTCACTATGAAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-232s1c1
Sequence:CCGGGCCACAAACAAGCTAGATCAACTCGAGTTGATCTAGCTTGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-80s21c1
Sequence:CCGGGCCCTGGCTATGGATCCAAATCTCGAGATTTGGATCCATAGCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001772.3-1263s21c1
Sequence:CCGGGCTATATTAACATCATCTTAGCTCGAGCTAAGATGATGTTAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-616s21c1
Sequence:CCGGTCACTCCTCGGTGCTCATAATCTCGAGATTATGAGCACCGAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001772
CD33 MISSION shRNA Lentiviral Transduction Particles
CD33 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001772.2-1202s1c1
Sequence:CCGGGCAATGGGTTTATAGACATTACTCGAGTAATGTCTATAAACCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1023s1c1
Sequence:CCGGGCTGCATTATGCTTCCCTCAACTCGAGTTGAGGGAAGCATAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-1038s1c1
Sequence:CCGGCCTCAACTTTCATGGGATGAACTCGAGTTCATCCCATGAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-840s1c1
Sequence:CCGGCCTCATCTTCTTCATAGTGAACTCGAGTTCACTATGAAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001772.2-232s1c1
Sequence:CCGGGCCACAAACAAGCTAGATCAACTCGAGTTGATCTAGCTTGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-80s21c1
Sequence:CCGGGCCCTGGCTATGGATCCAAATCTCGAGATTTGGATCCATAGCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001772.3-1263s21c1
Sequence:CCGGGCTATATTAACATCATCTTAGCTCGAGCTAAGATGATGTTAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001772.3-616s21c1
Sequence:CCGGTCACTCCTCGGTGCTCATAATCTCGAGATTATGAGCACCGAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021293
CD33 MISSION shRNA Bacterial Glycerol Stock
CD33 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-691s1c1
Sequence:CCGGAGCTCAATGTTACCCGGAAATCTCGAGATTTCCGGGTAACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021293.1-1694s1c1
Sequence:CCGGGCTATGAAGATAAAGGACTAACTCGAGTTAGTCCTTTATCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-900s1c1
Sequence:CCGGCCTGAGAATCCAAGACCCTTACTCGAGTAAGGGTCTTGGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-956s1c1
Sequence:CCGGCACTAAGATTTCCTTGGATTTCTCGAGAAATCCAAGGAAATCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-144s1c1
Sequence:CCGGCCCTCCATTAAGCTCACTTTACTCGAGTAAAGTGAGCTTAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021293
CD33 MISSION shRNA shRNA Plasmid DNA
CD33 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-691s1c1
Sequence:CCGGAGCTCAATGTTACCCGGAAATCTCGAGATTTCCGGGTAACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021293.1-1694s1c1
Sequence:CCGGGCTATGAAGATAAAGGACTAACTCGAGTTAGTCCTTTATCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-900s1c1
Sequence:CCGGCCTGAGAATCCAAGACCCTTACTCGAGTAAGGGTCTTGGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-956s1c1
Sequence:CCGGCACTAAGATTTCCTTGGATTTCTCGAGAAATCCAAGGAAATCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-144s1c1
Sequence:CCGGCCCTCCATTAAGCTCACTTTACTCGAGTAAAGTGAGCTTAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021293
CD33 MISSION shRNA Lentiviral Transduction Particles
CD33 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-691s1c1
Sequence:CCGGAGCTCAATGTTACCCGGAAATCTCGAGATTTCCGGGTAACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021293.1-1694s1c1
Sequence:CCGGGCTATGAAGATAAAGGACTAACTCGAGTTAGTCCTTTATCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-900s1c1
Sequence:CCGGCCTGAGAATCCAAGACCCTTACTCGAGTAAGGGTCTTGGATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-956s1c1
Sequence:CCGGCACTAAGATTTCCTTGGATTTCTCGAGAAATCCAAGGAAATCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021293.1-144s1c1
Sequence:CCGGCCCTCCATTAAGCTCACTTTACTCGAGTAAAGTGAGCTTAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks