EMAIL THIS PAGE TO A FRIEND

CD34

CD34 molecule

205 Gene Product Result for
Gene ID:
Human(947) Summary: The protein encoded by this gene may play a role in the attachment of stem cells to the bone marrow extracellular matrix or to stromal cells. This single-pass membrane protein is highly glycosylated and phosphorylated by protein kinase C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(12490) CD34 antigen
Rat(305081) CD34 molecule
chicken(419856) CD34 molecule
domestic cat(493884) CD34 molecule
dog(415130) CD34 molecule
cow(281051) CD34 molecule
Goat(100861223) CD34 molecule
sheep(101105675) CD34 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW10811F Anti-CD34 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA036722 Anti-CD34 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA036723 Anti-CD34 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4300690 Anti-CD34 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
WH0000947M1 Monoclonal Anti-CD34 antibody produced in mouse clone 5F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403649 Monoclonal Anti-CD34 antibody produced in mouse clone 5A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700160 Monoclonal Anti-CD34 antibody produced in mouse clone 4H11[APG], purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700736 Monoclonal Anti-CD34 antibody produced in mouse clone 581, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, immunohistochemistry pricing
SAB4700157 Monoclonal Anti-CD34 azide free antibody produced in mouse clone QBEnd-10, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700161 Monoclonal Anti-CD34-APC antibody produced in mouse clone 4H11[APG], purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700162 Monoclonal Anti-CD34-Biotin antibody produced in mouse clone 4H11[APG], purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700158 Monoclonal Anti-CD34-FITC antibody produced in mouse clone QBEnd-10, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700163 Monoclonal Anti-CD34-FITC antibody produced in mouse clone 4H11[APG], purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700703 Monoclonal Anti-CD34-FITC antibody produced in mouse clone 581, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, immunohistochemistry pricing
SAB4700159 Monoclonal Anti-CD34-PE antibody produced in mouse clone QBEnd-10, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700164 Monoclonal Anti-CD34-PE antibody produced in mouse clone 4H11[APG], purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700682 Monoclonal Anti-CD34-PE antibody produced in mouse clone 581, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry, immunohistochemistry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1334 Human CD34 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001773 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034351 MISSION® esiRNA esiRNA targeting mouse Cd34 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025109 Rosetta Predictions human pricing
NM_001773 Rosetta Predictions human pricing
NM_001107202 Rosetta Predictions rat pricing
NM_001111059 Rosetta Predictions mouse pricing
NM_133654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036767 predicted 551
2 SASI_Hs01_00036768 predicted 383
3 SASI_Hs02_00307376 predicted 1872
4 SASI_Hs01_00036769 predicted 1822
5 SASI_Hs01_00036770 predicted 518
6 SASI_Hs01_00036773 predicted 496
7 SASI_Hs02_00307377 predicted 509
8 SASI_Hs01_00036774 predicted 1587
9 SASI_Hs01_00036775 predicted 1586
10 SASI_Hs02_00307378 predicted 454
11 SASI_Hs01_00036766 predicted 533
12 SASI_Hs01_00036771 predicted 344
13 SASI_Hs01_00036772 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013635 predicted 342
2 SASI_Hs01_00013636 predicted 548
3 SASI_Hs01_00013637 predicted 380
4 SASI_Hs01_00013638 predicted 486
5 SASI_Hs01_00013642 predicted 518
6 SASI_Hs02_00332521 predicted 305
7 SASI_Hs02_00332522 predicted 500
8 SASI_Hs02_00332523 predicted 515
9 SASI_Hs02_00332524 predicted 543
10 SASI_Hs02_00332525 predicted 491
11 SASI_Hs01_00013634 predicted 536
12 SASI_Hs01_00013639 predicted 776
13 SASI_Hs01_00013640 predicted 770
14 SASI_Hs01_00013641 predicted 680
15 SASI_Hs01_00013643 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226515 predicted 491
2 SASI_Rn02_00226516 predicted 502
3 SASI_Rn02_00226517 predicted 194
4 SASI_Rn02_00226518 predicted 760
5 SASI_Rn02_00226519 predicted 747
6 SASI_Rn02_00226520 predicted 200
7 SASI_Rn02_00226521 predicted 621
8 SASI_Rn02_00226522 predicted 703
9 SASI_Rn02_00226523 predicted 595
10 SASI_Rn02_00226524 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306255 predicted 716
2 SASI_Mm02_00306256 predicted 718
3 SASI_Mm02_00306257 predicted 754
4 SASI_Mm02_00306258 predicted 879
5 SASI_Mm02_00306259 predicted 478
6 SASI_Mm02_00306260 predicted 544
7 SASI_Mm02_00306261 predicted 284
8 SASI_Mm02_00306262 predicted 722
9 SASI_Mm02_00306263 predicted 643
10 SASI_Mm02_00306264 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128049 predicted 721
2 SASI_Mm01_00128050 predicted 720
3 SASI_Mm01_00128051 predicted 751
4 SASI_Mm01_00128052 predicted 543
5 SASI_Mm01_00128053 predicted 286
6 SASI_Mm01_00128054 predicted 721
7 SASI_Mm01_00128055 predicted 641
8 SASI_Mm01_00128056 predicted 566
9 SASI_Mm01_00128057 predicted 1379
10 SASI_Mm01_00128058 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133654
VALIDATED
CD34 MISSION shRNA Bacterial Glycerol Stock
CD34 molecule
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-490s21c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1045s21c1
Sequence:CCGGCTTGGGCACCACTGGTTATTTCTCGAGAAATAACCAGTGGTGCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1115s21c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-291s21c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-406s1c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-1031s1c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-207s1c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-555s1c1
Sequence:CCGGCGAGTGCCATTAAGGGAGAAACTCGAGTTTCTCCCTTAATGGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-621s1c1
Sequence:CCGGGCCTGGAACTAAGTGAAGCATCTCGAGATGCTTCACTTAGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133654
VALIDATED
CD34 MISSION shRNA shRNA Plasmid DNA
CD34 molecule
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-490s21c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1045s21c1
Sequence:CCGGCTTGGGCACCACTGGTTATTTCTCGAGAAATAACCAGTGGTGCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1115s21c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-291s21c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-406s1c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-1031s1c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-207s1c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-555s1c1
Sequence:CCGGCGAGTGCCATTAAGGGAGAAACTCGAGTTTCTCCCTTAATGGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-621s1c1
Sequence:CCGGGCCTGGAACTAAGTGAAGCATCTCGAGATGCTTCACTTAGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133654
VALIDATED
CD34 MISSION shRNA Lentiviral Transduction Particles
CD34 molecule
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-490s21c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1045s21c1
Sequence:CCGGCTTGGGCACCACTGGTTATTTCTCGAGAAATAACCAGTGGTGCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-1115s21c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133654.3-291s21c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-406s1c1
Sequence:CCGGGCCTACTACTTCAGACAGTATCTCGAGATACTGTCTGAAGTAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-1031s1c1
Sequence:CCGGGACCCTTATTACACGGAGAATCTCGAGATTCTCCGTGTAATAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-207s1c1
Sequence:CCGGCCAATGAGTCTGTTGAGGAAACTCGAGTTTCCTCAACAGACTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133654.1-555s1c1
Sequence:CCGGCGAGTGCCATTAAGGGAGAAACTCGAGTTTCTCCCTTAATGGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133654.1-621s1c1
Sequence:CCGGGCCTGGAACTAAGTGAAGCATCTCGAGATGCTTCACTTAGTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001773
CD34 MISSION shRNA Bacterial Glycerol Stock
CD34 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-377s1c1
Sequence:CCGGCCTCTGTGATAACCTCAGTTTCTCGAGAAACTGAGGTTATCACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-1009s1c1
Sequence:CCGGACTGGCTATTTCCTGATGAATCTCGAGATTCATCAGGAAATAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-508s1c1
Sequence:CCGGCCTGGAAATGTTTCAGACCTTCTCGAGAAGGTCTGAAACATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-356s1c1
Sequence:CCGGCGACAGTCAAATTCACATCTACTCGAGTAGATGTGAATTTGACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-570s1c1
Sequence:CCGGCTATACATCATCTTCTCCTATCTCGAGATAGGAGAAGATGATGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001773
CD34 MISSION shRNA shRNA Plasmid DNA
CD34 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-377s1c1
Sequence:CCGGCCTCTGTGATAACCTCAGTTTCTCGAGAAACTGAGGTTATCACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-1009s1c1
Sequence:CCGGACTGGCTATTTCCTGATGAATCTCGAGATTCATCAGGAAATAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-508s1c1
Sequence:CCGGCCTGGAAATGTTTCAGACCTTCTCGAGAAGGTCTGAAACATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-356s1c1
Sequence:CCGGCGACAGTCAAATTCACATCTACTCGAGTAGATGTGAATTTGACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-570s1c1
Sequence:CCGGCTATACATCATCTTCTCCTATCTCGAGATAGGAGAAGATGATGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001773
CD34 MISSION shRNA Lentiviral Transduction Particles
CD34 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-377s1c1
Sequence:CCGGCCTCTGTGATAACCTCAGTTTCTCGAGAAACTGAGGTTATCACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-1009s1c1
Sequence:CCGGACTGGCTATTTCCTGATGAATCTCGAGATTCATCAGGAAATAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-508s1c1
Sequence:CCGGCCTGGAAATGTTTCAGACCTTCTCGAGAAGGTCTGAAACATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-356s1c1
Sequence:CCGGCGACAGTCAAATTCACATCTACTCGAGTAGATGTGAATTTGACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001773.1-570s1c1
Sequence:CCGGCTATACATCATCTTCTCCTATCTCGAGATAGGAGAAGATGATGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)