EMAIL THIS PAGE TO A FRIEND

CD36

CD36 molecule (thrombospondin receptor)

116 Gene Product Result for
Synonyms: BDPLT10 CHDS7 FAT GP3B GP4 GPIV PASIV SCARB3
Gene ID:
Human(948) Summary: The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12491) CD36 antigen
Rat(29184) CD36 molecule (thrombospondin receptor)
naked mole-rat(101703900) CD36 molecule (thrombospondin receptor)
domestic guinea pig(100730182) CD36 molecule (thrombospondin receptor)
Goat(100860958) CD36 molecule (thrombospondin receptor)
Domestic Rabbit(100008825) CD36 molecule (thrombospondin receptor)
Zebrafish(436636) CD36 antigen
cow(281052) CD36 molecule (thrombospondin receptor)
cow(518526) CD36 molecule (thrombospondin receptor)
domestic cat(101093842) CD36 molecule (thrombospondin receptor)
dog(475931) CD36 molecule (thrombospondin receptor)
chicken(417730) CD36 molecule (thrombospondin receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108653 Anti-CD36 affinity isolated antibody goat, rabbit, mouse, horse, pig, rat, bovine, human, horse, guinea pig
immunohistochemistry, western blot pricing
HPA002018 Anti-CD36 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV48129 Anti-CD36 antibody produced in rabbit affinity isolated antibody horse, rabbit, bovine, rabbit, canine, human, pig, rat
immunohistochemistry, western blot pricing
SAB2100376 Anti-CD36 antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, guinea pig, horse, human, rabbit, pig, rabbit, canine
western blot pricing
SAB4700165 Monoclonal Anti-CD36 antibody produced in mouse clone TR9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700166 Monoclonal Anti-CD36 antibody produced in mouse clone CB38 (NL07), purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700167 Monoclonal Anti-CD36-APC antibody produced in mouse clone CB38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700721 Monoclonal Anti-CD36-APC antibody produced in mouse clone CB38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700168 Monoclonal Anti-CD36-FITC antibody produced in mouse clone CB38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700169 Monoclonal Anti-CD36-PE antibody produced in mouse clone CB38, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000072 Rosetta Predictions human pricing
NM_001001547 Rosetta Predictions human pricing
NM_001001548 Rosetta Predictions human pricing
NM_001127443 Rosetta Predictions human pricing
NM_001127444 Rosetta Predictions human pricing
NM_031561 Rosetta Predictions rat pricing
NM_007643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075562 predicted 1129
2 SASI_Hs01_00075564 predicted 1382
3 SASI_Hs02_00301803 predicted 1332
4 SASI_Hs01_00075565 predicted 670
5 SASI_Hs01_00075566 predicted 653
6 SASI_Hs01_00075567 predicted 774
7 SASI_Hs01_00075568 predicted 1114
8 SASI_Hs01_00075570 predicted 538
9 SASI_Hs01_00075571 predicted 581
10 SASI_Hs02_00301804 predicted 769
11 SASI_Hs01_00075563 predicted 944
12 SASI_Hs01_00075569 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045662 predicted 1085
2 SASI_Hs01_00045664 predicted 1343
3 SASI_Hs02_00303817 predicted 1296
4 SASI_Hs01_00045665 predicted 631
5 SASI_Hs01_00045666 predicted 609
6 SASI_Hs01_00045667 predicted 737
7 SASI_Hs01_00045668 predicted 1073
8 SASI_Hs01_00045670 predicted 503
9 SASI_Hs01_00045671 predicted 545
10 SASI_Hs02_00303818 predicted 726
11 SASI_Hs01_00045663 predicted 1015
12 SASI_Hs01_00045669 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078660 predicted 1128
2 SASI_Hs01_00078662 predicted 1377
3 SASI_Hs02_00303819 predicted 1337
4 SASI_Hs01_00078663 predicted 665
5 SASI_Hs01_00078664 predicted 649
6 SASI_Hs01_00078665 predicted 771
7 SASI_Hs01_00078666 predicted 1112
8 SASI_Hs01_00078668 predicted 536
9 SASI_Hs01_00078669 predicted 583
10 SASI_Hs02_00303820 predicted 764
11 SASI_Hs01_00078661 predicted 948
12 SASI_Hs01_00078667 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329514 predicted 833
2 SASI_Hs02_00329515 predicted 1088
3 SASI_Hs02_00329516 predicted 1035
4 SASI_Hs02_00329517 predicted 372
5 SASI_Hs02_00329518 predicted 353
6 SASI_Hs02_00329519 predicted 480
7 SASI_Hs02_00329520 predicted 811
8 SASI_Hs02_00329521 predicted 249
9 SASI_Hs02_00329522 predicted 286
10 SASI_Hs02_00329523 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329524 predicted 1005
2 SASI_Hs02_00329525 predicted 1258
3 SASI_Hs02_00329526 predicted 1211
4 SASI_Hs02_00329527 predicted 549
5 SASI_Hs02_00329528 predicted 528
6 SASI_Hs02_00329529 predicted 651
7 SASI_Hs02_00329530 predicted 995
8 SASI_Hs02_00329531 predicted 425
9 SASI_Hs02_00329532 predicted 461
10 SASI_Hs02_00329533 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264778 predicted 1581
2 SASI_Rn01_00063697 predicted 1663
3 SASI_Rn02_00264779 predicted 1658
4 SASI_Rn01_00063701 predicted 666
5 SASI_Rn02_00264780 predicted 1106
6 SASI_Rn01_00063702 predicted 1291
7 SASI_Rn02_00264781 predicted 1741
8 SASI_Rn02_00264782 predicted 1504
9 SASI_Rn01_00063693 predicted 946
10 SASI_Rn01_00063694 predicted 1307
11 SASI_Rn01_00063695 predicted 1249
12 SASI_Rn01_00063696 predicted 874
13 SASI_Rn01_00063698 predicted 1456
14 SASI_Rn01_00063699 predicted 936
15 SASI_Rn01_00063700 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041883 predicted 982
2 SASI_Mm01_00041884 predicted 958
3 SASI_Mm01_00041885 predicted 358
4 SASI_Mm01_00041886 predicted 903
5 SASI_Mm01_00041887 predicted 1475
6 SASI_Mm01_00041888 predicted 1364
7 SASI_Mm02_00312127 predicted 1278
8 SASI_Mm01_00041889 predicted 1059
9 SASI_Mm01_00041890 predicted 1231
10 SASI_Mm01_00041892 predicted 934
11 SASI_Mm01_00041891 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000072
CD36 MISSION shRNA Bacterial Glycerol Stock
CD36 molecule (thrombospondin receptor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000072.2-1781s1c1
Sequence:CCGGGAAGTTACATATTAGGCCATACTCGAGTATGGCCTAATATGTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1131s1c1
Sequence:CCGGCCGACGTTAATCTGAAAGGAACTCGAGTTCCTTTCAGATTAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-382s1c1
Sequence:CCGGCCTGCTTATCCAGAAGACAATCTCGAGATTGTCTTCTGGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1551s1c1
Sequence:CCGGCCATTGGTGATGAGAAGGCAACTCGAGTTGCCTTCTCATCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-962s1c1
Sequence:CCGGGCCATAATCGACACATATAAACTCGAGTTTATATGTGTCGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1569s21c1
Sequence:CCGGACGGCTGCAGGTCAACCTATTCTCGAGAATAGGTTGACCTGCAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1476s21c1
Sequence:CCGGAGAACCTATTGATGGATTAAACTCGAGTTTAATCCATCAATAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000072
CD36 MISSION shRNA shRNA Plasmid DNA
CD36 molecule (thrombospondin receptor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000072.2-1781s1c1
Sequence:CCGGGAAGTTACATATTAGGCCATACTCGAGTATGGCCTAATATGTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1131s1c1
Sequence:CCGGCCGACGTTAATCTGAAAGGAACTCGAGTTCCTTTCAGATTAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-382s1c1
Sequence:CCGGCCTGCTTATCCAGAAGACAATCTCGAGATTGTCTTCTGGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1551s1c1
Sequence:CCGGCCATTGGTGATGAGAAGGCAACTCGAGTTGCCTTCTCATCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-962s1c1
Sequence:CCGGGCCATAATCGACACATATAAACTCGAGTTTATATGTGTCGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1569s21c1
Sequence:CCGGACGGCTGCAGGTCAACCTATTCTCGAGAATAGGTTGACCTGCAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1476s21c1
Sequence:CCGGAGAACCTATTGATGGATTAAACTCGAGTTTAATCCATCAATAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000072
CD36 MISSION shRNA Lentiviral Transduction Particles
CD36 molecule (thrombospondin receptor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000072.2-1781s1c1
Sequence:CCGGGAAGTTACATATTAGGCCATACTCGAGTATGGCCTAATATGTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1131s1c1
Sequence:CCGGCCGACGTTAATCTGAAAGGAACTCGAGTTCCTTTCAGATTAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-382s1c1
Sequence:CCGGCCTGCTTATCCAGAAGACAATCTCGAGATTGTCTTCTGGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-1551s1c1
Sequence:CCGGCCATTGGTGATGAGAAGGCAACTCGAGTTGCCTTCTCATCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000072.2-962s1c1
Sequence:CCGGGCCATAATCGACACATATAAACTCGAGTTTATATGTGTCGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1569s21c1
Sequence:CCGGACGGCTGCAGGTCAACCTATTCTCGAGAATAGGTTGACCTGCAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000072.3-1476s21c1
Sequence:CCGGAGAACCTATTGATGGATTAAACTCGAGTTTAATCCATCAATAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007643
CD36 MISSION shRNA Bacterial Glycerol Stock
CD36 molecule (thrombospondin receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007643.2-2861s1c1
Sequence:CCGGCCAGGGTAAGACACAGTGATACTCGAGTATCACTGTGTCTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1425s1c1
Sequence:CCGGGCAGGTCAACATATTGGTCAACTCGAGTTGACCAATATGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-981s1c1
Sequence:CCGGGCCAAGCTATTGCGACATGATCTCGAGATCATGTCGCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-937s1c1
Sequence:CCGGGCCATAATTGAGTCCTATAAACTCGAGTTTATAGGACTCAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1101s1c1
Sequence:CCGGCGGATCTGAAATCGACCTTAACTCGAGTTAAGGTCGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007643
CD36 MISSION shRNA shRNA Plasmid DNA
CD36 molecule (thrombospondin receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007643.2-2861s1c1
Sequence:CCGGCCAGGGTAAGACACAGTGATACTCGAGTATCACTGTGTCTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1425s1c1
Sequence:CCGGGCAGGTCAACATATTGGTCAACTCGAGTTGACCAATATGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-981s1c1
Sequence:CCGGGCCAAGCTATTGCGACATGATCTCGAGATCATGTCGCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-937s1c1
Sequence:CCGGGCCATAATTGAGTCCTATAAACTCGAGTTTATAGGACTCAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1101s1c1
Sequence:CCGGCGGATCTGAAATCGACCTTAACTCGAGTTAAGGTCGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007643
CD36 MISSION shRNA Lentiviral Transduction Particles
CD36 molecule (thrombospondin receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007643.2-2861s1c1
Sequence:CCGGCCAGGGTAAGACACAGTGATACTCGAGTATCACTGTGTCTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1425s1c1
Sequence:CCGGGCAGGTCAACATATTGGTCAACTCGAGTTGACCAATATGTTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-981s1c1
Sequence:CCGGGCCAAGCTATTGCGACATGATCTCGAGATCATGTCGCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-937s1c1
Sequence:CCGGGCCATAATTGAGTCCTATAAACTCGAGTTTATAGGACTCAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007643.2-1101s1c1
Sequence:CCGGCGGATCTGAAATCGACCTTAACTCGAGTTAAGGTCGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks