EMAIL THIS PAGE TO A FRIEND

CD37

CD37 molecule

185 Gene Product Result for
Synonyms: GP52-40 TSPAN26
UniProtKB ID: P11049, B4DVC1, Q3KPF9
Gene ID:
Human(951) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It may play a role in T-cell-B-cell interactions. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(12493) CD37 antigen
Rat(29185) CD37 molecule
dog(484382) CD37 molecule
cow(508751) CD37 molecule
domestic cat(101099165) CD37 molecule
sheep(101110864) CD37 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140801 MISSION® esiRNA esiRNA human CD37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040031 Rosetta Predictions human pricing
NM_001774 Rosetta Predictions human pricing
NM_017124 Rosetta Predictions rat pricing
NM_007645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034510 predicted 513
2 SASI_Hs01_00034511 predicted 644
3 SASI_Hs01_00034512 predicted 568
4 SASI_Hs01_00034513 predicted 648
5 SASI_Hs01_00034514 predicted 563
6 SASI_Hs01_00034515 predicted 562
7 SASI_Hs01_00034516 predicted 548
8 SASI_Hs01_00034517 predicted 384
9 SASI_Hs01_00034518 predicted 363
10 SASI_Hs01_00034519 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061231 predicted 546
2 SASI_Hs01_00061232 predicted 677
3 SASI_Hs01_00061233 predicted 606
4 SASI_Hs01_00061234 predicted 685
5 SASI_Hs01_00061235 predicted 600
6 SASI_Hs01_00061236 predicted 589
7 SASI_Hs01_00061237 predicted 583
8 SASI_Hs01_00061238 predicted 418
9 SASI_Hs01_00061239 predicted 401
10 SASI_Hs01_00061240 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095632 predicted 756
2 SASI_Rn01_00095633 predicted 615
3 SASI_Rn01_00095634 predicted 335
4 SASI_Rn01_00095635 predicted 620
5 SASI_Rn01_00095636 predicted 844
6 SASI_Rn01_00095637 predicted 445
7 SASI_Rn01_00095638 predicted 853
8 SASI_Rn01_00095639 predicted 476
9 SASI_Rn01_00095640 predicted 822
10 SASI_Rn01_00095641 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188648 predicted 356
2 SASI_Mm01_00188649 predicted 812
3 SASI_Mm01_00188650 predicted 670
4 SASI_Mm01_00188651 predicted 616
5 SASI_Mm01_00188652 predicted 628
6 SASI_Mm01_00188653 predicted 234
7 SASI_Mm02_00312130 predicted 392
8 SASI_Mm01_00188654 predicted 501
9 SASI_Mm01_00188655 predicted 662
10 SASI_Mm01_00188656 predicted 901
11 SASI_Mm01_00188657 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001774
CD37 MISSION shRNA Bacterial Glycerol Stock
CD37 molecule
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-205s21c1
Sequence:GTACCGGGATCTTCTGCTTCGGCATCTGCTCGAGCAGATGCCGAAGCAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-831s21c1
Sequence:GTACCGGGGCTGCACAACAACCTTATTTCTCGAGAAATAAGGTTGTTGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-242s21c1
Sequence:GTACCGGACCAGCTTCGTGTCCTTTGTGCTCGAGCACAAAGGACACGAAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-280s21c1
Sequence:GTACCGGTCTGCAGATCTGGTCCAAAGTCTCGAGACTTTGGACCAGATCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-924s21c1
Sequence:GTACCGGGAAACCTGGACCACGTCTACACTCGAGTGTAGACGTGGTCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-682s21c1
Sequence:GTACCGGCAACGACTCCACAATCCTAGACTCGAGTCTAGGATTGTGGAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-476s21c1
Sequence:GTACCGGTTGCGGGACGTCGTAGAGAAACTCGAGTTTCTCTACGACGTCCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-424s21c1
Sequence:GTACCGGGATCACCCTGGGAATCCTCATCTCGAGATGAGGATTCCCAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-611s21c1
Sequence:GTACCGGGTCCTCATCCTGAGAGGTAACCTCGAGGTTACCTCTCAGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001774.1-967s1c1
Sequence:CCGGGCTGCCTGTAAATATTTGTTTCTCGAGAAACAAATATTTACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-627s1c1
Sequence:CCGGCGACTCCACAATCCTAGATAACTCGAGTTATCTAGGATTGTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-348s1c1
Sequence:CCGGGCTCCTGTTTGCCACACAGATCTCGAGATCTGTGTGGCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-849s1c1
Sequence:CCGGCTCGATATTCCTGTGCAGAAACTCGAGTTTCTGCACAGGAATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-762s1c1
Sequence:CCGGCCTCCAGAAGTGGCTGCACAACTCGAGTTGTGCAGCCACTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001774
CD37 MISSION shRNA shRNA Plasmid DNA
CD37 molecule
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-205s21c1
Sequence:GTACCGGGATCTTCTGCTTCGGCATCTGCTCGAGCAGATGCCGAAGCAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-831s21c1
Sequence:GTACCGGGGCTGCACAACAACCTTATTTCTCGAGAAATAAGGTTGTTGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-242s21c1
Sequence:GTACCGGACCAGCTTCGTGTCCTTTGTGCTCGAGCACAAAGGACACGAAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-280s21c1
Sequence:GTACCGGTCTGCAGATCTGGTCCAAAGTCTCGAGACTTTGGACCAGATCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-924s21c1
Sequence:GTACCGGGAAACCTGGACCACGTCTACACTCGAGTGTAGACGTGGTCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-682s21c1
Sequence:GTACCGGCAACGACTCCACAATCCTAGACTCGAGTCTAGGATTGTGGAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-476s21c1
Sequence:GTACCGGTTGCGGGACGTCGTAGAGAAACTCGAGTTTCTCTACGACGTCCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-424s21c1
Sequence:GTACCGGGATCACCCTGGGAATCCTCATCTCGAGATGAGGATTCCCAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-611s21c1
Sequence:GTACCGGGTCCTCATCCTGAGAGGTAACCTCGAGGTTACCTCTCAGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001774.1-967s1c1
Sequence:CCGGGCTGCCTGTAAATATTTGTTTCTCGAGAAACAAATATTTACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-627s1c1
Sequence:CCGGCGACTCCACAATCCTAGATAACTCGAGTTATCTAGGATTGTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-348s1c1
Sequence:CCGGGCTCCTGTTTGCCACACAGATCTCGAGATCTGTGTGGCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-849s1c1
Sequence:CCGGCTCGATATTCCTGTGCAGAAACTCGAGTTTCTGCACAGGAATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-762s1c1
Sequence:CCGGCCTCCAGAAGTGGCTGCACAACTCGAGTTGTGCAGCCACTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001774
CD37 MISSION shRNA Lentiviral Transduction Particles
CD37 molecule
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-205s21c1
Sequence:GTACCGGGATCTTCTGCTTCGGCATCTGCTCGAGCAGATGCCGAAGCAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-831s21c1
Sequence:GTACCGGGGCTGCACAACAACCTTATTTCTCGAGAAATAAGGTTGTTGTGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-242s21c1
Sequence:GTACCGGACCAGCTTCGTGTCCTTTGTGCTCGAGCACAAAGGACACGAAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-280s21c1
Sequence:GTACCGGTCTGCAGATCTGGTCCAAAGTCTCGAGACTTTGGACCAGATCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-924s21c1
Sequence:GTACCGGGAAACCTGGACCACGTCTACACTCGAGTGTAGACGTGGTCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-682s21c1
Sequence:GTACCGGCAACGACTCCACAATCCTAGACTCGAGTCTAGGATTGTGGAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-476s21c1
Sequence:GTACCGGTTGCGGGACGTCGTAGAGAAACTCGAGTTTCTCTACGACGTCCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-424s21c1
Sequence:GTACCGGGATCACCCTGGGAATCCTCATCTCGAGATGAGGATTCCCAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001774.2-611s21c1
Sequence:GTACCGGGTCCTCATCCTGAGAGGTAACCTCGAGGTTACCTCTCAGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001774.1-967s1c1
Sequence:CCGGGCTGCCTGTAAATATTTGTTTCTCGAGAAACAAATATTTACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-627s1c1
Sequence:CCGGCGACTCCACAATCCTAGATAACTCGAGTTATCTAGGATTGTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-348s1c1
Sequence:CCGGGCTCCTGTTTGCCACACAGATCTCGAGATCTGTGTGGCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-849s1c1
Sequence:CCGGCTCGATATTCCTGTGCAGAAACTCGAGTTTCTGCACAGGAATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001774.1-762s1c1
Sequence:CCGGCCTCCAGAAGTGGCTGCACAACTCGAGTTGTGCAGCCACTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007645
VALIDATED
CD37 MISSION shRNA Bacterial Glycerol Stock
CD37 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-175s1c1
Sequence:CCGGCCTCATCAAGTACTTCCTCTTCTCGAGAAGAGGAAGTACTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-434s1c1
Sequence:CCGGCTCCTGTTTGCCACACAGATTCTCGAGAATCTGTGTGGCAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007645.2-717s1c1
Sequence:CCGGCCACCGTCTTTGATAAGCTCTCTCGAGAGAGCTTATCAAAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-256s1c1
Sequence:CCGGCCTCATTGACAAGACCAGCTTCTCGAGAAGCTGGTCTTGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-930s1c1
Sequence:CCGGCGCTCTCAATATTCCTGTGTACTCGAGTACACAGGAATATTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007645
VALIDATED
CD37 MISSION shRNA shRNA Plasmid DNA
CD37 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-175s1c1
Sequence:CCGGCCTCATCAAGTACTTCCTCTTCTCGAGAAGAGGAAGTACTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-434s1c1
Sequence:CCGGCTCCTGTTTGCCACACAGATTCTCGAGAATCTGTGTGGCAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007645.2-717s1c1
Sequence:CCGGCCACCGTCTTTGATAAGCTCTCTCGAGAGAGCTTATCAAAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-256s1c1
Sequence:CCGGCCTCATTGACAAGACCAGCTTCTCGAGAAGCTGGTCTTGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-930s1c1
Sequence:CCGGCGCTCTCAATATTCCTGTGTACTCGAGTACACAGGAATATTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007645
VALIDATED
CD37 MISSION shRNA Lentiviral Transduction Particles
CD37 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-175s1c1
Sequence:CCGGCCTCATCAAGTACTTCCTCTTCTCGAGAAGAGGAAGTACTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-434s1c1
Sequence:CCGGCTCCTGTTTGCCACACAGATTCTCGAGAATCTGTGTGGCAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007645.2-717s1c1
Sequence:CCGGCCACCGTCTTTGATAAGCTCTCTCGAGAGAGCTTATCAAAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-256s1c1
Sequence:CCGGCCTCATTGACAAGACCAGCTTCTCGAGAAGCTGGTCTTGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007645.2-930s1c1
Sequence:CCGGCGCTCTCAATATTCCTGTGTACTCGAGTACACAGGAATATTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks