EMAIL THIS PAGE TO A FRIEND

CD38

CD38 molecule

99 Gene Product Result for
Synonyms: T10
UniProtKB ID: P28907, O00121, O00122, Q96HY4
Gene ID:
Human(952) Summary: CD38 is a novel multifunctional ectoenzyme widely expressed in cells and tissues especially in leukocytes. CD38 also functions in cell adhesion,signal transduction and calcium signaling. [provided by RefSeq, Jul 2008]
Mouse(12494) CD38 antigen
Rat(25668) CD38 molecule
chicken(422827) CD38 molecule
cow(327677) CD38 molecule
domestic cat(101101308) CD38 molecule
dog(403756) CD38 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022132 Anti-CD38 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA052381 Anti-CD38 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5500063 Anti-CD38 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP149, tissue culture supernatant human (tested)
flow cytometry, immunohistochemistry pricing
WH0000952M2 Monoclonal Anti-CD38 antibody produced in mouse clone 4G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700170 Monoclonal Anti-CD38 antibody produced in mouse clone HIT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700171 Monoclonal Anti-CD38-APC antibody produced in mouse clone HIT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700172 Monoclonal Anti-CD38-Biotin antibody produced in mouse clone HIT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700173 Monoclonal Anti-CD38-FITC antibody produced in mouse clone HIT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700174 Monoclonal Anti-CD38-PE antibody produced in mouse clone HIT2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1336 Human CD38 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053231 MISSION® esiRNA esiRNA human CD38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001775 Rosetta Predictions human pricing
NM_013127 Rosetta Predictions rat pricing
NM_007646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238215 predicted 829
2 SASI_Hs01_00238216 predicted 391
3 SASI_Hs01_00238217 predicted 723
4 SASI_Hs01_00238218 predicted 645
5 SASI_Hs01_00238219 predicted 330
6 SASI_Hs01_00238220 predicted 571
7 SASI_Hs01_00238221 predicted 703
8 SASI_Hs01_00238222 predicted 800
9 SASI_Hs02_00332526 predicted 353
10 SASI_Hs01_00238223 predicted 304
11 SASI_Hs01_00238224 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043615 predicted 341
2 SASI_Rn01_00043616 predicted 318
3 SASI_Rn01_00043617 predicted 980
4 SASI_Rn02_00260909 predicted 365
5 SASI_Rn01_00043619 predicted 356
6 SASI_Rn01_00043620 predicted 711
7 SASI_Rn01_00043621 predicted 467
8 SASI_Rn01_00043622 predicted 735
9 SASI_Rn01_00043623 predicted 749
10 SASI_Rn02_00260910 predicted 916
11 SASI_Rn01_00043614 predicted 506
12 SASI_Rn01_00043618 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045682 predicted 717
2 SASI_Mm01_00045683 predicted 601
3 SASI_Mm01_00045684 predicted 266
4 SASI_Mm01_00045685 predicted 817
5 SASI_Mm01_00045686 predicted 545
6 SASI_Mm01_00045687 predicted 403
7 SASI_Mm01_00045688 predicted 795
8 SASI_Mm01_00045689 predicted 399
9 SASI_Mm01_00045690 predicted 396
10 SASI_Mm01_00045691 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001775
VALIDATED
CD38 MISSION shRNA Bacterial Glycerol Stock
CD38 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001775.2-1184s1c1
Sequence:CCGGGCATACCTTTATTGTGATCTACTCGAGTAGATCACAATAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-801s1c1
Sequence:CCGGCCAGAGAAGGTTCAGACACTACTCGAGTAGTGTCTGAACCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-979s1c1
Sequence:CCGGCTGAGGATTCATCTTGCACATCTCGAGATGTGCAAGATGAATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-575s1c1
Sequence:CCGGCCTCACATGGTGTGGTGAATTCTCGAGAATTCACCACACCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-353s1c1
Sequence:CCGGCCAAAGTGTATGGGATGCTTTCTCGAGAAAGCATCCCATACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001775
VALIDATED
CD38 MISSION shRNA shRNA Plasmid DNA
CD38 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001775.2-1184s1c1
Sequence:CCGGGCATACCTTTATTGTGATCTACTCGAGTAGATCACAATAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-801s1c1
Sequence:CCGGCCAGAGAAGGTTCAGACACTACTCGAGTAGTGTCTGAACCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-979s1c1
Sequence:CCGGCTGAGGATTCATCTTGCACATCTCGAGATGTGCAAGATGAATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-575s1c1
Sequence:CCGGCCTCACATGGTGTGGTGAATTCTCGAGAATTCACCACACCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-353s1c1
Sequence:CCGGCCAAAGTGTATGGGATGCTTTCTCGAGAAAGCATCCCATACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001775
VALIDATED
CD38 MISSION shRNA Lentiviral Transduction Particles
CD38 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001775.2-1184s1c1
Sequence:CCGGGCATACCTTTATTGTGATCTACTCGAGTAGATCACAATAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-801s1c1
Sequence:CCGGCCAGAGAAGGTTCAGACACTACTCGAGTAGTGTCTGAACCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-979s1c1
Sequence:CCGGCTGAGGATTCATCTTGCACATCTCGAGATGTGCAAGATGAATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-575s1c1
Sequence:CCGGCCTCACATGGTGTGGTGAATTCTCGAGAATTCACCACACCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001775.2-353s1c1
Sequence:CCGGCCAAAGTGTATGGGATGCTTTCTCGAGAAAGCATCCCATACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007646
CD38 MISSION shRNA Bacterial Glycerol Stock
CD38 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-589s1c1
Sequence:CCGGCCTATTACTGTGTTCTGGAAACTCGAGTTTCCAGAACACAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007646.2-1461s1c1
Sequence:CCGGCCACAGATATTCACATGGTAACTCGAGTTACCATGTGAATATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-822s1c1
Sequence:CCGGGCTGAAGATGATTGTGCAGAACTCGAGTTCTGCACAATCATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-391s1c1
Sequence:CCGGCCATGTAACAAGACTCTCTTTCTCGAGAAAGAGAGTCTTGTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-285s1c1
Sequence:CCGGCCAGGAGATACTGAGTACATTCTCGAGAATGTACTCAGTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007646
CD38 MISSION shRNA shRNA Plasmid DNA
CD38 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-589s1c1
Sequence:CCGGCCTATTACTGTGTTCTGGAAACTCGAGTTTCCAGAACACAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007646.2-1461s1c1
Sequence:CCGGCCACAGATATTCACATGGTAACTCGAGTTACCATGTGAATATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-822s1c1
Sequence:CCGGGCTGAAGATGATTGTGCAGAACTCGAGTTCTGCACAATCATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-391s1c1
Sequence:CCGGCCATGTAACAAGACTCTCTTTCTCGAGAAAGAGAGTCTTGTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-285s1c1
Sequence:CCGGCCAGGAGATACTGAGTACATTCTCGAGAATGTACTCAGTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007646
CD38 MISSION shRNA Lentiviral Transduction Particles
CD38 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-589s1c1
Sequence:CCGGCCTATTACTGTGTTCTGGAAACTCGAGTTTCCAGAACACAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007646.2-1461s1c1
Sequence:CCGGCCACAGATATTCACATGGTAACTCGAGTTACCATGTGAATATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-822s1c1
Sequence:CCGGGCTGAAGATGATTGTGCAGAACTCGAGTTCTGCACAATCATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-391s1c1
Sequence:CCGGCCATGTAACAAGACTCTCTTTCTCGAGAAAGAGAGTCTTGTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007646.2-285s1c1
Sequence:CCGGCCAGGAGATACTGAGTACATTCTCGAGAATGTACTCAGTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks