EMAIL THIS PAGE TO A FRIEND

CD3D

CD3d molecule, delta (CD3-TCR complex)

66 Gene Product Result for
Synonyms: CD3-DELTA T3D
UniProtKB ID: P04234, A8MVP6
Gene ID:
Human(915) Summary: The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]
Mouse(12500) CD3 antigen, delta polypeptide
Rat(25710) CD3 molecule, delta
chicken(396518) CD3d molecule, delta (CD3-TCR complex)
domestic cat(101083107) CD3d molecule, delta (CD3-TCR complex)
cow(281053) CD3d molecule, delta (CD3-TCR complex)
dog(479419) CD3d molecule, delta (CD3-TCR complex)
sheep(443397) CD3d molecule, delta (CD3-TCR complex)
domestic guinea pig(100727506) CD3d molecule, delta (CD3-TCR complex)
naked mole-rat(101712534) CD3d molecule, delta (CD3-TCR complex)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000732 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037231 MISSION® esiRNA esiRNA human CD3D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000732 Rosetta Predictions human pricing
NM_001040651 Rosetta Predictions human pricing
NM_013169 Rosetta Predictions rat pricing
NM_013487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085683 predicted 388
2 SASI_Hs01_00085684 predicted 450
3 SASI_Hs01_00085685 predicted 224
4 SASI_Hs01_00085686 predicted 272
5 SASI_Hs01_00085687 predicted 376
6 SASI_Hs01_00085688 predicted 388
7 SASI_Hs02_00303157 predicted 219
8 SASI_Hs01_00085689 predicted 348
9 SASI_Hs01_00085690 predicted 275
10 SASI_Hs01_00085691 predicted 216
11 SASI_Hs01_00085692 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228482 predicted 380
2 SASI_Hs01_00228483 predicted 227
3 SASI_Hs01_00228484 predicted 276
4 SASI_Hs01_00228485 predicted 377
5 SASI_Hs01_00228486 predicted 218
6 SASI_Hs01_00228487 predicted 352
7 SASI_Hs02_00309028 predicted 364
8 SASI_Hs01_00228488 predicted 273
9 SASI_Hs01_00228489 predicted 216
10 SASI_Hs01_00228490 predicted 284
11 SASI_Hs01_00228491 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077646 predicted 305
2 SASI_Rn01_00077647 predicted 300
3 SASI_Rn01_00077648 predicted 254
4 SASI_Rn01_00077649 predicted 304
5 SASI_Rn01_00077650 predicted 249
6 SASI_Rn01_00077651 predicted 197
7 SASI_Rn01_00077652 predicted 357
8 SASI_Rn02_00260992 predicted 296
9 SASI_Rn01_00077653 predicted 290
10 SASI_Rn01_00077654 predicted 250
11 SASI_Rn01_00077645 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075251 predicted 248
2 SASI_Mm01_00075252 predicted 316
3 SASI_Mm01_00075253 predicted 359
4 SASI_Mm01_00075254 predicted 303
5 SASI_Mm01_00075255 predicted 307
6 SASI_Mm01_00075256 predicted 293
7 SASI_Mm01_00075257 predicted 200
8 SASI_Mm01_00075258 predicted 202
9 SASI_Mm01_00075259 predicted 316
10 SASI_Mm01_00075260 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013487
CD3D MISSION shRNA Bacterial Glycerol Stock
CD3d molecule, delta (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-207s1c1
Sequence:CCGGCGAGGGATATATCTGTGTAATCTCGAGATTACACAGATATATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-124s1c1
Sequence:CCGGGCGTCATGCATCTAGATGGAACTCGAGTTCCATCTAGATGCATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-84s1c1
Sequence:CCGGACCGAATATGAGGACAAAGTACTCGAGTACTTTGTCCTCATATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-269s1c1
Sequence:CCGGCCATTACCGAATGTGCCAGAACTCGAGTTCTGGCACATTCGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-456s1c1
Sequence:CCGGCCTCTTCGAGATCGTGAAGATCTCGAGATCTTCACGATCTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013487
CD3D MISSION shRNA shRNA Plasmid DNA
CD3d molecule, delta (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-207s1c1
Sequence:CCGGCGAGGGATATATCTGTGTAATCTCGAGATTACACAGATATATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-124s1c1
Sequence:CCGGGCGTCATGCATCTAGATGGAACTCGAGTTCCATCTAGATGCATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-84s1c1
Sequence:CCGGACCGAATATGAGGACAAAGTACTCGAGTACTTTGTCCTCATATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-269s1c1
Sequence:CCGGCCATTACCGAATGTGCCAGAACTCGAGTTCTGGCACATTCGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-456s1c1
Sequence:CCGGCCTCTTCGAGATCGTGAAGATCTCGAGATCTTCACGATCTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013487
CD3D MISSION shRNA Lentiviral Transduction Particles
CD3d molecule, delta (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-207s1c1
Sequence:CCGGCGAGGGATATATCTGTGTAATCTCGAGATTACACAGATATATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-124s1c1
Sequence:CCGGGCGTCATGCATCTAGATGGAACTCGAGTTCCATCTAGATGCATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-84s1c1
Sequence:CCGGACCGAATATGAGGACAAAGTACTCGAGTACTTTGTCCTCATATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-269s1c1
Sequence:CCGGCCATTACCGAATGTGCCAGAACTCGAGTTCTGGCACATTCGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013487.2-456s1c1
Sequence:CCGGCCTCTTCGAGATCGTGAAGATCTCGAGATCTTCACGATCTCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000732
CD3D MISSION shRNA Bacterial Glycerol Stock
CD3d molecule, delta (CD3-TCR complex)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000732.3-1359s1c1
Sequence:CCGGGCATCCATTGAGATGATAATACTCGAGTATTATCATCTCAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-255s1c1
Sequence:CCGGCCGTGCAAGTTCATTATCGAACTCGAGTTCGATAATGAACTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-150s1c1
Sequence:CCGGCACTGCTCTCAGACATTACAACTCGAGTTGTAATGTCTGAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-427s1c1
Sequence:CCGGGTTGAGGAATGACCAGGTCTACTCGAGTAGACCTGGTCATTCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-89s1c1
Sequence:CCGGGAGGACAGAGTGTTTGTGAATCTCGAGATTCACAAACACTCTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-328s21c1
Sequence:CCGGTCCTGGACCCACGAGGAATATCTCGAGATATTCCTCGTGGGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-198s21c1
Sequence:CCGGCCCTTCAAGATACCTATAGAGCTCGAGCTCTATAGGTATCTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-596s21c1
Sequence:CCGGAGATCGAGATGATGCTCAGTACTCGAGTACTGAGCATCATCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-352s21c1
Sequence:CCGGGGTGTAATGGGACAGATATATCTCGAGATATATCTGTCCCATTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000732
CD3D MISSION shRNA shRNA Plasmid DNA
CD3d molecule, delta (CD3-TCR complex)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000732.3-1359s1c1
Sequence:CCGGGCATCCATTGAGATGATAATACTCGAGTATTATCATCTCAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-255s1c1
Sequence:CCGGCCGTGCAAGTTCATTATCGAACTCGAGTTCGATAATGAACTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-150s1c1
Sequence:CCGGCACTGCTCTCAGACATTACAACTCGAGTTGTAATGTCTGAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-427s1c1
Sequence:CCGGGTTGAGGAATGACCAGGTCTACTCGAGTAGACCTGGTCATTCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-89s1c1
Sequence:CCGGGAGGACAGAGTGTTTGTGAATCTCGAGATTCACAAACACTCTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-328s21c1
Sequence:CCGGTCCTGGACCCACGAGGAATATCTCGAGATATTCCTCGTGGGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-198s21c1
Sequence:CCGGCCCTTCAAGATACCTATAGAGCTCGAGCTCTATAGGTATCTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-596s21c1
Sequence:CCGGAGATCGAGATGATGCTCAGTACTCGAGTACTGAGCATCATCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-352s21c1
Sequence:CCGGGGTGTAATGGGACAGATATATCTCGAGATATATCTGTCCCATTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000732
CD3D MISSION shRNA Lentiviral Transduction Particles
CD3d molecule, delta (CD3-TCR complex)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000732.3-1359s1c1
Sequence:CCGGGCATCCATTGAGATGATAATACTCGAGTATTATCATCTCAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-255s1c1
Sequence:CCGGCCGTGCAAGTTCATTATCGAACTCGAGTTCGATAATGAACTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-150s1c1
Sequence:CCGGCACTGCTCTCAGACATTACAACTCGAGTTGTAATGTCTGAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-427s1c1
Sequence:CCGGGTTGAGGAATGACCAGGTCTACTCGAGTAGACCTGGTCATTCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000732.3-89s1c1
Sequence:CCGGGAGGACAGAGTGTTTGTGAATCTCGAGATTCACAAACACTCTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-328s21c1
Sequence:CCGGTCCTGGACCCACGAGGAATATCTCGAGATATTCCTCGTGGGTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-198s21c1
Sequence:CCGGCCCTTCAAGATACCTATAGAGCTCGAGCTCTATAGGTATCTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-596s21c1
Sequence:CCGGAGATCGAGATGATGCTCAGTACTCGAGTACTGAGCATCATCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000732.4-352s21c1
Sequence:CCGGGGTGTAATGGGACAGATATATCTCGAGATATATCTGTCCCATTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks