EMAIL THIS PAGE TO A FRIEND

CD3E

CD3e molecule, epsilon (CD3-TCR complex)

149 Gene Product Result for
Synonyms: T3E TCRE
UniProtKB ID: P07766, A8K997
Gene ID:
Human(916) Summary: The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]
Mouse(12501) CD3 antigen, epsilon polypeptide
Rat(315609) CD3 molecule, epsilon
naked mole-rat(101711464) CD3e molecule, epsilon (CD3-TCR complex)
domestic guinea pig(100727781) CD3e molecule, epsilon (CD3-TCR complex)
sheep(443437) CD3e molecule, epsilon (CD3-TCR complex)
Domestic Rabbit(100008616) CD3e molecule, epsilon (CD3-TCR complex)
chicken(396062) CD3e molecule, epsilon (CD3-TCR complex)
cow(281054) CD3e molecule, epsilon (CD3-TCR complex)
domestic cat(493936) CD3e molecule, epsilon (CD3-TCR complex)
dog(442981) CD3e molecule, epsilon (CD3-TCR complex)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500057 Anti-CD3 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP162, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB5500058 Anti-CD3 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP7, tissue culture supernatant human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4700041 Anti-CD3, low endotoxin antibody, Mouse monoclonal clone OKT3, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry pricing
C7930 Anti-CD3, T Cell antibody produced in rabbit whole antiserum pig, human, bovine, canine, mouse, Psammomys (sand rat), sheep, rat, feline, chicken
immunohistochemistry, western blot pricing
HPA040957 Anti-CD3E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043955 Anti-CD3E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4300686 Anti-CD3E antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
C7048 Monoclonal Anti-CD3 antibody produced in mouse clone UCHT-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700040 Monoclonal Anti-CD3 antibody produced in mouse clone OKT3, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700044 Monoclonal Anti-CD3 antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700045 Monoclonal Anti-CD3 antibody produced in mouse clone MEM-92, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700050 Monoclonal Anti-CD3 antibody produced in mouse clone APA1/1, purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry pricing
SAB4700042 Monoclonal Anti-CD3 azide free antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700046 Monoclonal Anti-CD3-APC antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700047 Monoclonal Anti-CD3-Biotin antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700048 Monoclonal Anti-CD3-FITC antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F0522 Monoclonal Anti-CD3−FITC antibody produced in mouse clone UCHT-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700049 Monoclonal Anti-CD3-PE antibody produced in mouse clone MEM-57, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700051 Monoclonal Anti-CD3-PE antibody produced in mouse clone APA1/1, purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry pricing
P5810 Monoclonal Anti-CD3−PE antibody produced in mouse clone UCHT-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700552 Monoclonal Anti-Cd3e antibody produced in hamster clone 145-2C11, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
WH0000916M4 Monoclonal Anti-CD3E antibody produced in mouse clone 4C1, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
AMAB90876 Monoclonal Anti-CD3E antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1466, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90879 Monoclonal Anti-CD3E antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1497, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700553 Monoclonal Anti-Cd3e low endotoxin antibody produced in hamster clone 145-2C11, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB1403644 Monoclonal Anti-CD3E, (C-terminal) antibody produced in mouse clone 3E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700554 Monoclonal Anti-Cd3e-APC antibody produced in hamster clone 145-2C11, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700555 Monoclonal Anti-Cd3e-FITC antibody produced in hamster clone 145-2C11, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-785 Anti-CD3ε Antibody, clone APA1/1 200 µg, Detect CD3ε using this Anti-CD3ε Antibody, clone APA1/1 validated for use in FC, IP, WB & IC. pricing
CBL150F Anti-CD3 Antibody, clone UCHT1, FITC conjugated 100 assays, Anti-CD3 Antibody, clone UCHT1, FITC conjugated is an antibody against CD3 for use in FC, IH. pricing
MABF173C Anti-CD3 (human), PE, clone SK7 Antibody 25 tests, This Anti-CD3 (human), PE, clone SK7 Antibody is validated for use in Flow Cytometry for the detection of CD3. pricing
MABF173E Anti-CD3 (human), PerCP, clone SK7 Antibody 25 tests, Anti-CD3 (human), PerCP, clone SK7 Antibody is an antibody against CD3 for use in Flow Cytometry. pricing
MABF175E Anti-CD3 (human), redFluor™ 710, clone UCHT1 Antibody 25 tests, This mouse monoclonal Anti-CD3 Antibody (human), redFluor™ 710, clone UCHT1, Cat. No. MABF1758 is validated for use in Flow Cytometry, for the detection of CD3. pricing
MABF174A Anti-CD3 (human), violetFluor™ 450, clone SK7 Antibody 25 tests, Anti-CD3 (human), violetFluor™ 450, clone SK7 Antibody is an antibody against CD3 for use in Flow Cytometry. pricing
MABF316 Anti-CD3ε (mouse) Antibody, APC, clone 145-2C11 100 µg, Detect CD3ε using this armenian hamster monoclonal antibody, Anti-CD3ε (mouse) Antibody, APC, clone 145-2C11 validated for use in Flow Cytometry, IHC, Activity Assay, IP & western blotting. pricing
MABF317 Anti-CD3ε (mouse) Antibody, PE, clone 145-2C11 200 µg, Anti-CD3ε (mouse) Antibody, PE, clone 145-2C11 is a highly specific armenian hamster monoclonal antibody, that targets CD3ε & has been tested in Flow Cytometry, IHC, Activity Assay, IP & western blotting. pricing
MABF318 Anti-CD3ε (mouse) Antibody, PE/Cy5, clone 145-2C11 100 µg, Detect CD3ε using this armenian hamster monoclonal antibody, Anti-CD3ε (mouse) Antibody, PE/Cy5, clone 145-2C11 validated for use in Flow Cytometry, IHC, Activity Assay, IP & western blotting. pricing
CBL150-I Anti-CD3e Antibody, clone UCHT1 100 μg, Anti-CD3e Antibody, clone UCHT1 is an antibody against CD3e for use in Flow Cytometry, Immunoprecipitation, ELISA, Immunocytochemistry, Immunohistochemistry, Affects Function. pricing
MABF157E Anti-CD3e (Mouse), clone 145-2C11, biotin conjugate Antibody 25 μg, Anti-CD3e (Mouse), clone 145-2C11, biotin conjugate Antibody detects level of CD3e and has been published and validated for use in Flow Cytometry. pricing
MABF158A Anti-CD3e (Mouse), PE-Cy7, clone 145-2C11 Antibody 25 μg, This armenian hamster monoclonal Anti-CD3e Antibody (Mouse), PE-Cy7, clone 145-2C11, Cat. No. MABF1582 is validated for use in Flow Cytometry, for the detection of CD3e. pricing
MABF158B Anti-CD3e (Mouse), PerCP-Cy5.5, clone 145-2C11 Antibody 25 μg, This armenian hamster monoclonal Anti-CD3e Antibody (Mouse), PerCP-Cy5.5, clone 145-2C11, Cat. No. MABF1584 is validated for use in Flow Cytometry, for the detection of CD3e. pricing
FCMAB227F Milli-Mark™ Anti-mouse CD3-FITC Antibody, clone 145-2C11 100 tests, This Milli-Mark Anti-mouse CD3-FITC Antibody, clone 145-2C11 is validated for use in FC for the detection of mouse CD3. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000733 Rosetta Predictions human pricing
NM_001108140 Rosetta Predictions rat pricing
NM_007648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091025 predicted 644
2 SASI_Hs01_00091026 predicted 448
3 SASI_Hs01_00091027 predicted 854
4 SASI_Hs01_00091028 predicted 842
5 SASI_Hs01_00091029 predicted 473
6 SASI_Hs01_00091030 predicted 805
7 SASI_Hs02_00303158 predicted 335
8 SASI_Hs01_00091033 predicted 526
9 SASI_Hs01_00091034 predicted 518
10 SASI_Hs02_00303159 predicted 426
11 SASI_Hs01_00091031 predicted 260
12 SASI_Hs01_00091032 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235754 predicted 705
2 SASI_Rn02_00235755 predicted 413
3 SASI_Rn02_00235756 predicted 640
4 SASI_Rn02_00235757 predicted 466
5 SASI_Rn02_00235758 predicted 314
6 SASI_Rn02_00235759 predicted 737
7 SASI_Rn02_00235760 predicted 256
8 SASI_Rn02_00235761 predicted 366
9 SASI_Rn02_00235762 predicted 416
10 SASI_Rn02_00235763 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312132 predicted 341
2 SASI_Mm01_00141524 predicted 636
3 SASI_Mm01_00141525 predicted 450
4 SASI_Mm01_00141526 predicted 242
5 SASI_Mm01_00141527 predicted 614
6 SASI_Mm01_00141529 predicted 204
7 SASI_Mm01_00141531 predicted 400
8 SASI_Mm01_00141532 predicted 205
9 SASI_Mm01_00141533 predicted 390
10 SASI_Mm02_00312133 predicted 203
11 SASI_Mm01_00141528 predicted 612
12 SASI_Mm01_00141530 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000733
CD3E MISSION shRNA Bacterial Glycerol Stock
CD3e molecule, epsilon (CD3-TCR complex)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-525s21c1
Sequence:CCGGTGGAGCAAAGTGGTTATTATGCTCGAGCATAATAACCACTTTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-635s21c1
Sequence:CCGGGTGATGTCGGTGGCCACAATTCTCGAGAATTGTGGCCACCGACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000733.2-1076s1c1
Sequence:CCGGCCCAAAGTATTCCATCTACTTCTCGAGAAGTAGATGGAATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-137s1c1
Sequence:CCGGGCCTCTTATCAGTTGGCGTTTCTCGAGAAACGCCAACTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-264s1c1
Sequence:CCGGTGAAATACTATGGCAACACAACTCGAGTTGTGTTGCCATAGTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-688s1c1
Sequence:CCGGGACCTGTATTCTGGCCTGAATCTCGAGATTCAGGCCAGAATACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-537s1c1
Sequence:CCGGGCTGGTTTACTACTGGAGCAACTCGAGTTGCTCCAGTAGTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000733
CD3E MISSION shRNA shRNA Plasmid DNA
CD3e molecule, epsilon (CD3-TCR complex)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-525s21c1
Sequence:CCGGTGGAGCAAAGTGGTTATTATGCTCGAGCATAATAACCACTTTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-635s21c1
Sequence:CCGGGTGATGTCGGTGGCCACAATTCTCGAGAATTGTGGCCACCGACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000733.2-1076s1c1
Sequence:CCGGCCCAAAGTATTCCATCTACTTCTCGAGAAGTAGATGGAATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-137s1c1
Sequence:CCGGGCCTCTTATCAGTTGGCGTTTCTCGAGAAACGCCAACTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-264s1c1
Sequence:CCGGTGAAATACTATGGCAACACAACTCGAGTTGTGTTGCCATAGTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-688s1c1
Sequence:CCGGGACCTGTATTCTGGCCTGAATCTCGAGATTCAGGCCAGAATACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-537s1c1
Sequence:CCGGGCTGGTTTACTACTGGAGCAACTCGAGTTGCTCCAGTAGTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000733
CD3E MISSION shRNA Lentiviral Transduction Particles
CD3e molecule, epsilon (CD3-TCR complex)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-525s21c1
Sequence:CCGGTGGAGCAAAGTGGTTATTATGCTCGAGCATAATAACCACTTTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000733.3-635s21c1
Sequence:CCGGGTGATGTCGGTGGCCACAATTCTCGAGAATTGTGGCCACCGACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000733.2-1076s1c1
Sequence:CCGGCCCAAAGTATTCCATCTACTTCTCGAGAAGTAGATGGAATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-137s1c1
Sequence:CCGGGCCTCTTATCAGTTGGCGTTTCTCGAGAAACGCCAACTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-264s1c1
Sequence:CCGGTGAAATACTATGGCAACACAACTCGAGTTGTGTTGCCATAGTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-688s1c1
Sequence:CCGGGACCTGTATTCTGGCCTGAATCTCGAGATTCAGGCCAGAATACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000733.2-537s1c1
Sequence:CCGGGCTGGTTTACTACTGGAGCAACTCGAGTTGCTCCAGTAGTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007648
CD3E MISSION shRNA Bacterial Glycerol Stock
CD3e molecule, epsilon (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-149s1c1
Sequence:CCGGGCCGAGAACATTGAATACAAACTCGAGTTTGTATTCAATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-253s1c1
Sequence:CCGGGCTGCCTCAGAAGCATGATAACTCGAGTTATCATGCTTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-178s1c1
Sequence:CCGGCTCAGGAACCAGTGTAGAGTTCTCGAGAACTCTACACTGGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-453s1c1
Sequence:CCGGGCTTGCTGATGGTCATTTATTCTCGAGAATAAATGACCATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-410s1c1
Sequence:CCGGGCAGTAGCCATAATCATCATTCTCGAGAATGATGATTATGGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007648
CD3E MISSION shRNA shRNA Plasmid DNA
CD3e molecule, epsilon (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-149s1c1
Sequence:CCGGGCCGAGAACATTGAATACAAACTCGAGTTTGTATTCAATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-253s1c1
Sequence:CCGGGCTGCCTCAGAAGCATGATAACTCGAGTTATCATGCTTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-178s1c1
Sequence:CCGGCTCAGGAACCAGTGTAGAGTTCTCGAGAACTCTACACTGGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-453s1c1
Sequence:CCGGGCTTGCTGATGGTCATTTATTCTCGAGAATAAATGACCATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-410s1c1
Sequence:CCGGGCAGTAGCCATAATCATCATTCTCGAGAATGATGATTATGGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007648
CD3E MISSION shRNA Lentiviral Transduction Particles
CD3e molecule, epsilon (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-149s1c1
Sequence:CCGGGCCGAGAACATTGAATACAAACTCGAGTTTGTATTCAATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-253s1c1
Sequence:CCGGGCTGCCTCAGAAGCATGATAACTCGAGTTATCATGCTTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-178s1c1
Sequence:CCGGCTCAGGAACCAGTGTAGAGTTCTCGAGAACTCTACACTGGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-453s1c1
Sequence:CCGGGCTTGCTGATGGTCATTTATTCTCGAGAATAAATGACCATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007648.1-410s1c1
Sequence:CCGGGCAGTAGCCATAATCATCATTCTCGAGAATGATGATTATGGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks