EMAIL THIS PAGE TO A FRIEND

CD3EAP

CD3e molecule, epsilon associated protein

Synonyms: ASE-1 ASE1 CAST PAF49
UniProtKB ID: O15446, Q32N11, Q7Z5U2, Q9UPF6
Gene ID:
Mouse(70333) CD3E antigen, epsilon polypeptide associated protein
Rat(680493) CD3e molecule, epsilon associated protein
domestic guinea pig(100721585) CD3e molecule, epsilon associated protein
naked mole-rat(101700793) CD3e molecule, epsilon associated protein
sheep(101113091) CD3e molecule, epsilon associated protein
dog(612284) CD3e molecule, epsilon associated protein
domestic cat(101083470) CD3e molecule, epsilon associated protein
cow(617937) CD3e molecule, epsilon associated protein
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012099 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149981 MISSION® esiRNA esiRNA human CD3EAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012099 Rosetta Predictions human pricing
NM_001109416 Rosetta Predictions rat pricing
NM_145822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229388 predicted 600
2 SASI_Hs01_00229389 predicted 700
3 SASI_Hs01_00229390 predicted 505
4 SASI_Hs01_00229391 predicted 594
5 SASI_Hs01_00229392 predicted 1483
6 SASI_Hs01_00229393 predicted 668
7 SASI_Hs01_00229394 predicted 722
8 SASI_Hs01_00229395 predicted 689
9 SASI_Hs01_00229396 predicted 1404
10 SASI_Hs01_00229397 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248197 predicted 239
2 SASI_Rn02_00248198 predicted 805
3 SASI_Rn02_00248199 predicted 1698
4 SASI_Rn02_00248200 predicted 952
5 SASI_Rn02_00248201 predicted 271
6 SASI_Rn02_00248202 predicted 1479
7 SASI_Rn02_00248203 predicted 1382
8 SASI_Rn02_00248204 predicted 1764
9 SASI_Rn02_00248205 predicted 1109
10 SASI_Rn02_00248206 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020396 predicted 519
2 SASI_Mm01_00020397 predicted 249
3 SASI_Mm01_00020398 predicted 907
4 SASI_Mm01_00020399 predicted 218
5 SASI_Mm01_00020400 predicted 795
6 SASI_Mm01_00020402 predicted 420
7 SASI_Mm01_00020403 predicted 367
8 SASI_Mm02_00341284 predicted 531
9 SASI_Mm01_00020405 predicted 218
10 SASI_Mm02_00341285 predicted 640
11 SASI_Mm01_00020401 predicted 1038
12 SASI_Mm01_00020404 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145822
CD3EAP MISSION shRNA Bacterial Glycerol Stock
CD3e molecule, epsilon associated protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-670s1c1
Sequence:CCGGGAGGTATTTCATGCAGGAGGACTCGAGTCCTCCTGCATGAAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-134s1c1
Sequence:CCGGCCAGATACAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-1145s1c1
Sequence:CCGGGCTGCACTTCCAGATGACTTTCTCGAGAAAGTCATCTGGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-661s1c1
Sequence:CCGGGAAGAGAAAGAGGTATTTCATCTCGAGATGAAATACCTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-383s1c1
Sequence:CCGGCCTCAAGAATATCTTCTCTCTCTCGAGAGAGAGAAGATATTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-951s21c1
Sequence:CCGGGATGGTATAGTGGCTGACTCTCTCGAGAGAGTCAGCCACTATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-1098s21c1
Sequence:CCGGGTGACCGAACATTCAGAACATCTCGAGATGTTCTGAATGTTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145822
CD3EAP MISSION shRNA shRNA Plasmid DNA
CD3e molecule, epsilon associated protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-670s1c1
Sequence:CCGGGAGGTATTTCATGCAGGAGGACTCGAGTCCTCCTGCATGAAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-134s1c1
Sequence:CCGGCCAGATACAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-1145s1c1
Sequence:CCGGGCTGCACTTCCAGATGACTTTCTCGAGAAAGTCATCTGGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-661s1c1
Sequence:CCGGGAAGAGAAAGAGGTATTTCATCTCGAGATGAAATACCTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-383s1c1
Sequence:CCGGCCTCAAGAATATCTTCTCTCTCTCGAGAGAGAGAAGATATTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-951s21c1
Sequence:CCGGGATGGTATAGTGGCTGACTCTCTCGAGAGAGTCAGCCACTATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-1098s21c1
Sequence:CCGGGTGACCGAACATTCAGAACATCTCGAGATGTTCTGAATGTTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145822
CD3EAP MISSION shRNA Lentiviral Transduction Particles
CD3e molecule, epsilon associated protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-670s1c1
Sequence:CCGGGAGGTATTTCATGCAGGAGGACTCGAGTCCTCCTGCATGAAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-134s1c1
Sequence:CCGGCCAGATACAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-1145s1c1
Sequence:CCGGGCTGCACTTCCAGATGACTTTCTCGAGAAAGTCATCTGGAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-661s1c1
Sequence:CCGGGAAGAGAAAGAGGTATTTCATCTCGAGATGAAATACCTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145822.1-383s1c1
Sequence:CCGGCCTCAAGAATATCTTCTCTCTCTCGAGAGAGAGAAGATATTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-951s21c1
Sequence:CCGGGATGGTATAGTGGCTGACTCTCTCGAGAGAGTCAGCCACTATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145822.2-1098s21c1
Sequence:CCGGGTGACCGAACATTCAGAACATCTCGAGATGTTCTGAATGTTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012099
VALIDATED
CD3EAP MISSION shRNA Bacterial Glycerol Stock
CD3e molecule, epsilon associated protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2275s1c1
Sequence:CCGGCCAGTCATTAAAGGAGCTGTTCTCGAGAACAGCTCCTTTAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012099.1-603s1c1
Sequence:CCGGGATACGGAGCTGTGGCTTATTCTCGAGAATAAGCCACAGCTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1238s1c1
Sequence:CCGGCAAGAAGAGGAAGAAGCCCAACTCGAGTTGGGCTTCTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1277s1c1
Sequence:CCGGGCCAGAAGACAAGACAGTGAACTCGAGTTCACTGTCTTGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1289s1c1
Sequence:CCGGGACAGTGAAGCAGGAACAGATCTCGAGATCTGTTCCTGCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1769s1c1
Sequence:CCGGGAAAGAGAGAGGTCACACAGTCTCGAGACTGTGTGACCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1253s1c1
Sequence:CCGGGCCCAAAGGGAAAGAAACCTTCTCGAGAAGGTTTCTTTCCCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1262s1c1
Sequence:CCGGGAAAGAAACCTTCGAGCCAGACTCGAGTCTGGCTCGAAGGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2957s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATAACTCGAGTTATCCTAGCACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1298s1c1
Sequence:CCGGGCAGGAACAGATTAACACTGACTCGAGTCAGTGTTAATCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-1305s1c1
Sequence:CCGGCAGATTAACACTGAGCCTCTACTCGAGTAGAGGCTCAGTGTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-2029s1c1
Sequence:CCGGCCGGGAAACTGAGGAACTAAACTCGAGTTTAGTTCCTCAGTTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012099
VALIDATED
CD3EAP MISSION shRNA shRNA Plasmid DNA
CD3e molecule, epsilon associated protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2275s1c1
Sequence:CCGGCCAGTCATTAAAGGAGCTGTTCTCGAGAACAGCTCCTTTAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012099.1-603s1c1
Sequence:CCGGGATACGGAGCTGTGGCTTATTCTCGAGAATAAGCCACAGCTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1238s1c1
Sequence:CCGGCAAGAAGAGGAAGAAGCCCAACTCGAGTTGGGCTTCTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1277s1c1
Sequence:CCGGGCCAGAAGACAAGACAGTGAACTCGAGTTCACTGTCTTGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1289s1c1
Sequence:CCGGGACAGTGAAGCAGGAACAGATCTCGAGATCTGTTCCTGCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1769s1c1
Sequence:CCGGGAAAGAGAGAGGTCACACAGTCTCGAGACTGTGTGACCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1253s1c1
Sequence:CCGGGCCCAAAGGGAAAGAAACCTTCTCGAGAAGGTTTCTTTCCCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1262s1c1
Sequence:CCGGGAAAGAAACCTTCGAGCCAGACTCGAGTCTGGCTCGAAGGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2957s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATAACTCGAGTTATCCTAGCACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1298s1c1
Sequence:CCGGGCAGGAACAGATTAACACTGACTCGAGTCAGTGTTAATCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-1305s1c1
Sequence:CCGGCAGATTAACACTGAGCCTCTACTCGAGTAGAGGCTCAGTGTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-2029s1c1
Sequence:CCGGCCGGGAAACTGAGGAACTAAACTCGAGTTTAGTTCCTCAGTTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012099
VALIDATED
CD3EAP MISSION shRNA Lentiviral Transduction Particles
CD3e molecule, epsilon associated protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2275s1c1
Sequence:CCGGCCAGTCATTAAAGGAGCTGTTCTCGAGAACAGCTCCTTTAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012099.1-603s1c1
Sequence:CCGGGATACGGAGCTGTGGCTTATTCTCGAGAATAAGCCACAGCTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1238s1c1
Sequence:CCGGCAAGAAGAGGAAGAAGCCCAACTCGAGTTGGGCTTCTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1277s1c1
Sequence:CCGGGCCAGAAGACAAGACAGTGAACTCGAGTTCACTGTCTTGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1289s1c1
Sequence:CCGGGACAGTGAAGCAGGAACAGATCTCGAGATCTGTTCCTGCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012099.1-1769s1c1
Sequence:CCGGGAAAGAGAGAGGTCACACAGTCTCGAGACTGTGTGACCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1253s1c1
Sequence:CCGGGCCCAAAGGGAAAGAAACCTTCTCGAGAAGGTTTCTTTCCCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1262s1c1
Sequence:CCGGGAAAGAAACCTTCGAGCCAGACTCGAGTCTGGCTCGAAGGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012099.1-2957s1c1
Sequence:CCGGCCTCCCAAAGTGCTAGGATAACTCGAGTTATCCTAGCACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012099.1-1298s1c1
Sequence:CCGGGCAGGAACAGATTAACACTGACTCGAGTCAGTGTTAATCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-1305s1c1
Sequence:CCGGCAGATTAACACTGAGCCTCTACTCGAGTAGAGGCTCAGTGTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012099.1-2029s1c1
Sequence:CCGGCCGGGAAACTGAGGAACTAAACTCGAGTTTAGTTCCTCAGTTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks