EMAIL THIS PAGE TO A FRIEND

CD3G

CD3g molecule, gamma (CD3-TCR complex)

61 Gene Product Result for
Synonyms: CD3-GAMMA T3G
UniProtKB ID: P09693, Q2HIZ6
Gene ID:
Human(917) Summary: The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]
Mouse(12502) CD3 antigen, gamma polypeptide
Rat(300678) CD3 molecule, gamma
domestic cat(101089292) CD3g molecule, gamma (CD3-TCR complex)
cow(281055) CD3g molecule, gamma (CD3-TCR complex)
Horse(100062960) CD3g molecule, gamma (CD3-TCR complex)
dog(489383) CD3g molecule, gamma (CD3-TCR complex)
sheep(443398) CD3g molecule, gamma (CD3-TCR complex)
naked mole-rat(101712197) CD3g molecule, gamma (CD3-TCR complex)
domestic guinea pig(100726670) CD3g molecule, gamma (CD3-TCR complex)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038681 MISSION® esiRNA esiRNA human CD3G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000073 Rosetta Predictions human pricing
NM_001077646 Rosetta Predictions rat pricing
XM_217136 Rosetta Predictions rat pricing
NM_009850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137804 predicted 522
2 SASI_Hs01_00137805 predicted 501
3 SASI_Hs01_00137806 predicted 507
4 SASI_Hs01_00137807 predicted 528
5 SASI_Hs01_00137808 predicted 558
6 SASI_Hs01_00137809 predicted 525
7 SASI_Hs01_00137810 predicted 498
8 SASI_Hs01_00137811 predicted 502
9 SASI_Hs01_00137812 predicted 524
10 SASI_Hs01_00137813 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207692 predicted 391
2 SASI_Rn02_00207693 predicted 284
3 SASI_Rn02_00207694 predicted 228
4 SASI_Rn02_00207695 predicted 388
5 SASI_Rn02_00207696 predicted 231
6 SASI_Rn02_00207697 predicted 389
7 SASI_Rn02_00207698 predicted 302
8 SASI_Rn02_00207699 predicted 395
9 SASI_Rn02_00207700 predicted 351
10 SASI_Rn02_00207701 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142201 predicted 487
2 SASI_Rn01_00142202 predicted 367
3 SASI_Rn01_00142203 predicted 295
4 SASI_Rn01_00142204 predicted 403
5 SASI_Rn01_00142205 predicted 234
6 SASI_Rn01_00142206 predicted 366
7 SASI_Rn01_00142207 predicted 226
8 SASI_Rn01_00142208 predicted 435
9 SASI_Rn01_00142209 predicted 507
10 SASI_Rn01_00142210 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058219 predicted 282
2 SASI_Mm01_00058220 predicted 268
3 SASI_Mm01_00058221 predicted 265
4 SASI_Mm02_00317234 predicted 237
5 SASI_Mm01_00058222 predicted 313
6 SASI_Mm01_00058223 predicted 515
7 SASI_Mm01_00058224 predicted 298
8 SASI_Mm01_00058225 predicted 519
9 SASI_Mm01_00058226 predicted 442
10 SASI_Mm01_00058227 predicted 287
11 SASI_Mm01_00058218 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000073
CD3G MISSION shRNA Bacterial Glycerol Stock
CD3g molecule, gamma (CD3-TCR complex)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-770s21c1
Sequence:CCGGGAAAGGCCATCAGAGCAAATTCTCGAGAATTTGCTCTGATGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-953s21c1
Sequence:CCGGTAATTCACATGGCTCAAATATCTCGAGATATTTGAGCCATGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-163s21c1
Sequence:CCGGACCACTTGGTTAAGGTGTATGCTCGAGCATACACCTTAACCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-428s21c1
Sequence:CCGGTGGCTTTCTCTTTGCTGAAATCTCGAGATTTCAGCAAAGAGAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-223s1c1
Sequence:CCGGCGGCTTCCTAACTGAAGATAACTCGAGTTATCTTCAGTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-553s1c1
Sequence:CCGGCCACCTTCAAGGAAACCAGTTCTCGAGAACTGGTTTCCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-334s1c1
Sequence:CCGGGTATTACAGAATGTGTCAGAACTCGAGTTCTGACACATTCTGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-350s1c1
Sequence:CCGGCAGAACTGCATTGAACTAAATCTCGAGATTTAGTTCAATGCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-71s1c1
Sequence:CCGGCTGGCTATCATTCTTCTTCAACTCGAGTTGAAGAAGAATGATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000073
CD3G MISSION shRNA shRNA Plasmid DNA
CD3g molecule, gamma (CD3-TCR complex)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-770s21c1
Sequence:CCGGGAAAGGCCATCAGAGCAAATTCTCGAGAATTTGCTCTGATGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-953s21c1
Sequence:CCGGTAATTCACATGGCTCAAATATCTCGAGATATTTGAGCCATGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-163s21c1
Sequence:CCGGACCACTTGGTTAAGGTGTATGCTCGAGCATACACCTTAACCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-428s21c1
Sequence:CCGGTGGCTTTCTCTTTGCTGAAATCTCGAGATTTCAGCAAAGAGAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-223s1c1
Sequence:CCGGCGGCTTCCTAACTGAAGATAACTCGAGTTATCTTCAGTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-553s1c1
Sequence:CCGGCCACCTTCAAGGAAACCAGTTCTCGAGAACTGGTTTCCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-334s1c1
Sequence:CCGGGTATTACAGAATGTGTCAGAACTCGAGTTCTGACACATTCTGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-350s1c1
Sequence:CCGGCAGAACTGCATTGAACTAAATCTCGAGATTTAGTTCAATGCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-71s1c1
Sequence:CCGGCTGGCTATCATTCTTCTTCAACTCGAGTTGAAGAAGAATGATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000073
CD3G MISSION shRNA Lentiviral Transduction Particles
CD3g molecule, gamma (CD3-TCR complex)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-770s21c1
Sequence:CCGGGAAAGGCCATCAGAGCAAATTCTCGAGAATTTGCTCTGATGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000073.2-953s21c1
Sequence:CCGGTAATTCACATGGCTCAAATATCTCGAGATATTTGAGCCATGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-163s21c1
Sequence:CCGGACCACTTGGTTAAGGTGTATGCTCGAGCATACACCTTAACCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000073.2-428s21c1
Sequence:CCGGTGGCTTTCTCTTTGCTGAAATCTCGAGATTTCAGCAAAGAGAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-223s1c1
Sequence:CCGGCGGCTTCCTAACTGAAGATAACTCGAGTTATCTTCAGTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-553s1c1
Sequence:CCGGCCACCTTCAAGGAAACCAGTTCTCGAGAACTGGTTTCCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-334s1c1
Sequence:CCGGGTATTACAGAATGTGTCAGAACTCGAGTTCTGACACATTCTGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-350s1c1
Sequence:CCGGCAGAACTGCATTGAACTAAATCTCGAGATTTAGTTCAATGCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000073.1-71s1c1
Sequence:CCGGCTGGCTATCATTCTTCTTCAACTCGAGTTGAAGAAGAATGATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009850
CD3G MISSION shRNA Bacterial Glycerol Stock
CD3g molecule, gamma (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-427s1c1
Sequence:CCGGCCTGCAAGTGTATTACAGAATCTCGAGATTCTGTAATACACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-527s1c1
Sequence:CCGGGCTCTTGGTGTATATCTCATTCTCGAGAATGAGATATACACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-316s1c1
Sequence:CCGGGAGCATAATAAGTCCTCTAAACTCGAGTTTAGAGGACTTATTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-475s1c1
Sequence:CCGGAGGCACCATATCCGGCTTTATCTCGAGATAAAGCCGGATATGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-661s1c1
Sequence:CCGGCCAAGGAAACCAACTGAGGAACTCGAGTTCCTCAGTTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009850
CD3G MISSION shRNA shRNA Plasmid DNA
CD3g molecule, gamma (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-427s1c1
Sequence:CCGGCCTGCAAGTGTATTACAGAATCTCGAGATTCTGTAATACACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-527s1c1
Sequence:CCGGGCTCTTGGTGTATATCTCATTCTCGAGAATGAGATATACACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-316s1c1
Sequence:CCGGGAGCATAATAAGTCCTCTAAACTCGAGTTTAGAGGACTTATTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-475s1c1
Sequence:CCGGAGGCACCATATCCGGCTTTATCTCGAGATAAAGCCGGATATGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-661s1c1
Sequence:CCGGCCAAGGAAACCAACTGAGGAACTCGAGTTCCTCAGTTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009850
CD3G MISSION shRNA Lentiviral Transduction Particles
CD3g molecule, gamma (CD3-TCR complex)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-427s1c1
Sequence:CCGGCCTGCAAGTGTATTACAGAATCTCGAGATTCTGTAATACACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-527s1c1
Sequence:CCGGGCTCTTGGTGTATATCTCATTCTCGAGAATGAGATATACACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-316s1c1
Sequence:CCGGGAGCATAATAAGTCCTCTAAACTCGAGTTTAGAGGACTTATTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-475s1c1
Sequence:CCGGAGGCACCATATCCGGCTTTATCTCGAGATAAAGCCGGATATGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009850.1-661s1c1
Sequence:CCGGCCAAGGAAACCAACTGAGGAACTCGAGTTCCTCAGTTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks