EMAIL THIS PAGE TO A FRIEND

CD40

CD40 molecule, TNF receptor superfamily member 5

Synonyms: Bp50 CDW40 TNFRSF5 p50
Gene ID:
Human(958) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been found to be essential in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(21939) CD40 antigen
Rat(171369) CD40 molecule, TNF receptor superfamily member 5
Zebrafish(100270764) CD40 antigen
cow(286849) CD40 molecule, TNF receptor superfamily member 5
Horse(100034049) CD40 molecule, TNF receptor superfamily member 5
domestic cat(101085363) CD40 molecule, TNF receptor superfamily member 5
dog(403469) CD40 molecule, TNF receptor superfamily member 5
chicken(395385) CD40 molecule, TNF receptor superfamily member 5
sheep(443232) CD40 molecule, TNF receptor superfamily member 5
naked mole-rat(101715501) CD40 molecule, TNF receptor superfamily member 5
domestic guinea pig(100728791) CD40 molecule, TNF receptor superfamily member 5
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C9224 Anti-CD40 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
AV41929 Anti-CD40 antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
HPA031567 Anti-CD40 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031568 Anti-CD40 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103449 Anti-CD40, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, pig, horse, human
western blot pricing
SAB4503674 Anti-CD40, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
pricing
SAB4504270 Anti-phospho-TNFRSF5 (pThr254) antibody produced in rabbit affinity isolated antibody rat, human, mouse
pricing
C5987 Monoclonal Anti-CD40 antibody produced in mouse clone 82105, purified immunoglobulin, lyophilized powder human
ELISA, microarray, western blot pricing
WH0000958M1 Monoclonal Anti-CD40 antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90905 Monoclonal Anti-CD40 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1673, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700175 Monoclonal Anti-CD40 azide free antibody produced in mouse clone HI40a, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700177 Monoclonal Anti-CD40-FITC antibody produced in mouse clone HI40a, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700178 Monoclonal Anti-CD40-PE antibody produced in mouse clone HI40a, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001250 Rosetta Predictions human pricing
NM_152854 Rosetta Predictions human pricing
NM_134360 Rosetta Predictions rat pricing
NM_011611 Rosetta Predictions mouse pricing
NM_170701 Rosetta Predictions mouse pricing
NM_170702 Rosetta Predictions mouse pricing
NM_170703 Rosetta Predictions mouse pricing
NM_170704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013152 predicted 240
2 SASI_Hs01_00013153 predicted 229
3 SASI_Hs02_00331425 predicted 258
4 SASI_Hs02_00331426 predicted 879
5 SASI_Hs01_00013154 predicted 220
6 SASI_Hs02_00331427 predicted 344
7 SASI_Hs01_00013155 predicted 244
8 SASI_Hs01_00013156 predicted 277
9 SASI_Hs01_00013157 predicted 867
10 SASI_Hs02_00331428 predicted 236
11 SASI_Hs01_00013151 predicted 221
12 SASI_Hs01_00013158 predicted 903
13 SASI_Hs01_00013159 predicted 927
14 SASI_Hs01_00013160 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146833 predicted 244
2 SASI_Hs01_00146834 predicted 228
3 SASI_Hs02_00366798 predicted 261
4 SASI_Hs02_00366799 predicted 819
5 SASI_Hs01_00146835 predicted 215
6 SASI_Hs02_00366800 predicted 353
7 SASI_Hs01_00146836 predicted 245
8 SASI_Hs01_00146837 predicted 275
9 SASI_Hs01_00146838 predicted 804
10 SASI_Hs02_00366801 predicted 236
11 SASI_Hs01_00146832 predicted 220
12 SASI_Hs01_00146839 predicted 841
13 SASI_Hs01_00146840 predicted 867
14 SASI_Hs01_00146841 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084393 predicted 427
2 SASI_Rn02_00267922 predicted 423
3 SASI_Rn01_00084394 predicted 311
4 SASI_Rn02_00267923 predicted 615
5 SASI_Rn01_00084396 predicted 271
6 SASI_Rn01_00084397 predicted 468
7 SASI_Rn01_00084398 predicted 435
8 SASI_Rn01_00084399 predicted 421
9 SASI_Rn01_00084400 predicted 471
10 SASI_Rn01_00084402 predicted 748
11 SASI_Rn01_00084395 predicted 888
12 SASI_Rn01_00084401 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106290 predicted 252
2 SASI_Mm01_00106291 predicted 323
3 SASI_Mm01_00106292 predicted 1265
4 SASI_Mm01_00106293 predicted 1219
5 SASI_Mm01_00106294 predicted 244
6 SASI_Mm01_00106295 predicted 1282
7 SASI_Mm01_00106296 predicted 322
8 SASI_Mm01_00106297 predicted 1163
9 SASI_Mm01_00106298 predicted 1339
10 SASI_Mm01_00106299 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066097 predicted 247
2 SASI_Mm01_00066098 predicted 317
3 SASI_Mm01_00066099 predicted 249
4 SASI_Mm01_00066100 predicted 320
5 SASI_Mm01_00066101 predicted 1269
6 SASI_Mm01_00066102 predicted 597
7 SASI_Mm01_00066103 predicted 125
8 SASI_Mm01_00066104 predicted 955
9 SASI_Mm01_00066105 predicted 565
10 SASI_Mm01_00066106 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192556 predicted 248
2 SASI_Mm01_00192557 predicted 326
3 SASI_Mm01_00192558 predicted 1185
4 SASI_Mm01_00192559 predicted 1136
5 SASI_Mm01_00192560 predicted 243
6 SASI_Mm01_00192561 predicted 1194
7 SASI_Mm01_00192562 predicted 318
8 SASI_Mm01_00192563 predicted 1081
9 SASI_Mm01_00192564 predicted 1256
10 SASI_Mm01_00192565 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147110 predicted 243
2 SASI_Mm01_00147111 predicted 325
3 SASI_Mm02_00343583 predicted 1155
4 SASI_Mm01_00147113 predicted 1101
5 SASI_Mm01_00147114 predicted 1121
6 SASI_Mm01_00147115 predicted 976
7 SASI_Mm01_00147116 predicted 236
8 SASI_Mm01_00147117 predicted 267
9 SASI_Mm01_00147118 predicted 1067
10 SASI_Mm01_00147119 predicted 948
11 SASI_Mm01_00147112 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022190 predicted 243
2 SASI_Mm01_00022191 predicted 318
3 SASI_Mm02_00343584 predicted 1219
4 SASI_Mm01_00022193 predicted 1159
5 SASI_Mm01_00022194 predicted 1176
6 SASI_Mm01_00022195 predicted 1039
7 SASI_Mm01_00022196 predicted 230
8 SASI_Mm01_00022197 predicted 258
9 SASI_Mm01_00022198 predicted 1130
10 SASI_Mm01_00022199 predicted 1000
11 SASI_Mm01_00022192 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001250
CD40 MISSION shRNA Bacterial Glycerol Stock
CD40 molecule, TNF receptor superfamily member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-606s1c1
Sequence:CCGGGCAGGCACAAACAAGACTGATCTCGAGATCAGTCTTGTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-232s1c1
Sequence:CCGGCAGAGTTCACTGAAACGGAATCTCGAGATTCCGTTTCAGTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-825s1c1
Sequence:CCGGCCAGTGCAGGAGACTTTACATCTCGAGATGTAAAGTCTCCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-530s1c1
Sequence:CCGGCTCCAATGTGTCATCTGCTTTCTCGAGAAAGCAGATGACACATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-686s1c1
Sequence:CCGGGATCCTGTTTGCCATCCTCTTCTCGAGAAGAGGATGGCAAACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-251s21c1
Sequence:CCGGATGCCTTCCTTGCGGTGAAAGCTCGAGCTTTCACCGCAAGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1346s21c1
Sequence:CCGGAGCAGGAGACTGGCTAAATAACTCGAGTTATTTAGCCAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-702s21c1
Sequence:CCGGCTCTTGGTGCTGGTCTTTATCCTCGAGGATAAAGACCAGCACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1128s21c1
Sequence:CCGGTCCAGTCTCCCAACTTGTATTCTCGAGAATACAAGTTGGGAGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001250
CD40 MISSION shRNA shRNA Plasmid DNA
CD40 molecule, TNF receptor superfamily member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-606s1c1
Sequence:CCGGGCAGGCACAAACAAGACTGATCTCGAGATCAGTCTTGTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-232s1c1
Sequence:CCGGCAGAGTTCACTGAAACGGAATCTCGAGATTCCGTTTCAGTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-825s1c1
Sequence:CCGGCCAGTGCAGGAGACTTTACATCTCGAGATGTAAAGTCTCCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-530s1c1
Sequence:CCGGCTCCAATGTGTCATCTGCTTTCTCGAGAAAGCAGATGACACATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-686s1c1
Sequence:CCGGGATCCTGTTTGCCATCCTCTTCTCGAGAAGAGGATGGCAAACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-251s21c1
Sequence:CCGGATGCCTTCCTTGCGGTGAAAGCTCGAGCTTTCACCGCAAGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1346s21c1
Sequence:CCGGAGCAGGAGACTGGCTAAATAACTCGAGTTATTTAGCCAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-702s21c1
Sequence:CCGGCTCTTGGTGCTGGTCTTTATCCTCGAGGATAAAGACCAGCACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1128s21c1
Sequence:CCGGTCCAGTCTCCCAACTTGTATTCTCGAGAATACAAGTTGGGAGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001250
CD40 MISSION shRNA Lentiviral Transduction Particles
CD40 molecule, TNF receptor superfamily member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-606s1c1
Sequence:CCGGGCAGGCACAAACAAGACTGATCTCGAGATCAGTCTTGTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-232s1c1
Sequence:CCGGCAGAGTTCACTGAAACGGAATCTCGAGATTCCGTTTCAGTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-825s1c1
Sequence:CCGGCCAGTGCAGGAGACTTTACATCTCGAGATGTAAAGTCTCCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-530s1c1
Sequence:CCGGCTCCAATGTGTCATCTGCTTTCTCGAGAAAGCAGATGACACATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001250.3-686s1c1
Sequence:CCGGGATCCTGTTTGCCATCCTCTTCTCGAGAAGAGGATGGCAAACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-251s21c1
Sequence:CCGGATGCCTTCCTTGCGGTGAAAGCTCGAGCTTTCACCGCAAGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1346s21c1
Sequence:CCGGAGCAGGAGACTGGCTAAATAACTCGAGTTATTTAGCCAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001250.4-702s21c1
Sequence:CCGGCTCTTGGTGCTGGTCTTTATCCTCGAGGATAAAGACCAGCACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001250.4-1128s21c1
Sequence:CCGGTCCAGTCTCCCAACTTGTATTCTCGAGAATACAAGTTGGGAGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011611
CD40 MISSION shRNA Bacterial Glycerol Stock
CD40 molecule, TNF receptor superfamily member 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011611.1-1169s1c1
Sequence:CCGGGCAGGGTACTGGCTAAATAAACTCGAGTTTATTTAGCCAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-188s1c1
Sequence:CCGGCCCATGTGACTCAGGCGAATTCTCGAGAATTCGCCTGAGTCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-727s1c1
Sequence:CCGGTGGAAGATTATCCCGGTCATACTCGAGTATGACCGGGATAATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-672s1c1
Sequence:CCGGCCAAAGGATAATGAGATGTTACTCGAGTAACATCTCATTATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011611
CD40 MISSION shRNA shRNA Plasmid DNA
CD40 molecule, TNF receptor superfamily member 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011611.1-1169s1c1
Sequence:CCGGGCAGGGTACTGGCTAAATAAACTCGAGTTTATTTAGCCAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-188s1c1
Sequence:CCGGCCCATGTGACTCAGGCGAATTCTCGAGAATTCGCCTGAGTCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-727s1c1
Sequence:CCGGTGGAAGATTATCCCGGTCATACTCGAGTATGACCGGGATAATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-672s1c1
Sequence:CCGGCCAAAGGATAATGAGATGTTACTCGAGTAACATCTCATTATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011611
CD40 MISSION shRNA Lentiviral Transduction Particles
CD40 molecule, TNF receptor superfamily member 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011611.1-1169s1c1
Sequence:CCGGGCAGGGTACTGGCTAAATAAACTCGAGTTTATTTAGCCAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-188s1c1
Sequence:CCGGCCCATGTGACTCAGGCGAATTCTCGAGAATTCGCCTGAGTCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-727s1c1
Sequence:CCGGTGGAAGATTATCCCGGTCATACTCGAGTATGACCGGGATAATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011611.1-672s1c1
Sequence:CCGGCCAAAGGATAATGAGATGTTACTCGAGTAACATCTCATTATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks