EMAIL THIS PAGE TO A FRIEND

CD40LG

CD40 ligand

144 Gene Product Result for
Synonyms: CD154 CD40L HIGM1 IGM IMD3 T-BAM TNFSF5 TRAP gp39 hCD40L
UniProtKB ID: P29965
Gene ID:
Human(959) Summary: The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]
Mouse(21947) CD40 ligand
Rat(84349) CD40 ligand
Zebrafish(793819) CD40 ligand
cow(282387) CD40 ligand
Horse(100054624) CD40 ligand
domestic cat(493850) CD40 ligand
dog(403468) CD40 ligand
chicken(395485) CD40 ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C6487 Anti-CD40 Ligand antibody produced in goat affinity isolated antibody, lyophilized powder human
flow cytometry, western blot pricing
SAB2100377 Anti-CD40LG antibody produced in rabbit affinity isolated antibody rabbit, sheep, canine, human, horse, bovine, mouse, rat, pig
western blot pricing
HPA045827 Anti-CD40LG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1306506 ANTI-TRAP(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1306595 ANTI-TRAP(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4700595 Monoclonal Anti-CD154 antibody produced in hamster clone MR-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700596 Monoclonal Anti-CD154 low endotoxin antibody produced in hamster clone MR-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700597 Monoclonal Anti-CD154-FITC antibody produced in hamster clone MR-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
WH0000959M1 Monoclonal Anti-CD40LG antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403650 Monoclonal Anti-CD40LG, (C-terminal) antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000074 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138531 MISSION® esiRNA esiRNA human CD40LG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000074 Rosetta Predictions human pricing
NM_053353 Rosetta Predictions rat pricing
NM_011616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237786 predicted 541
2 SASI_Hs01_00237788 predicted 477
3 SASI_Hs01_00237789 predicted 336
4 SASI_Hs02_00301805 predicted 292
5 SASI_Hs01_00237790 predicted 493
6 SASI_Hs01_00237792 predicted 586
7 SASI_Hs01_00237793 predicted 292
8 SASI_Hs02_00301806 predicted 709
9 SASI_Hs01_00237795 predicted 676
10 SASI_Hs02_00301807 predicted 273
11 SASI_Hs01_00237787 predicted 226
12 SASI_Hs01_00237791 predicted 619
13 SASI_Hs01_00237794 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041217 predicted 464
2 SASI_Rn01_00041218 predicted 489
3 SASI_Rn01_00041219 predicted 371
4 SASI_Rn01_00041220 predicted 245
5 SASI_Rn01_00041221 predicted 359
6 SASI_Rn01_00041222 predicted 198
7 SASI_Rn01_00041223 predicted 389
8 SASI_Rn02_00265819 predicted 437
9 SASI_Rn01_00041224 predicted 469
10 SASI_Rn01_00041225 predicted 217
11 SASI_Rn01_00041226 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049475 predicted 456
2 SASI_Mm01_00049476 predicted 236
3 SASI_Mm02_00321052 predicted 870
4 SASI_Mm01_00049477 predicted 451
5 SASI_Mm02_00321053 predicted 826
6 SASI_Mm01_00049478 predicted 508
7 SASI_Mm01_00049479 predicted 413
8 SASI_Mm01_00049480 predicted 835
9 SASI_Mm01_00049481 predicted 227
10 SASI_Mm01_00049482 predicted 869
11 SASI_Mm01_00049474 predicted 295
12 SASI_Mm01_00049483 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011616
CD40LG MISSION shRNA Bacterial Glycerol Stock
CD40 ligand
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-294s21c1
Sequence:CCGGTGTCAAGGATATAACGTTAAACTCGAGTTTAACGTTATATCCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011616.2-872s21c1
Sequence:CCGGCTGTGTTGAACTGCCTATTTACTCGAGTAAATAGGCAGTTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-620s21c1
Sequence:CCGGTCTTACTCAAGGCGGCAAATACTCGAGTATTTGCCGCCTTGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011616.2-871s1c1
Sequence:CCGGCCTGTGTTGAACTGCCTATTTCTCGAGAAATAGGCAGTTCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-529s1c1
Sequence:CCGGCAAGTCACCTTCTGCTCTAATCTCGAGATTAGAGCAGAAGGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-718s1c1
Sequence:CCGGGTGTTTGTCAACGTGACTGAACTCGAGTTCAGTCACGTTGACAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-286s1c1
Sequence:CCGGGAAGACCTTGTCAAGGATATACTCGAGTATATCCTTGACAAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-426s1c1
Sequence:CCGGGTGGGCCAAGAAAGGATATTACTCGAGTAATATCCTTTCTTGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011616
CD40LG MISSION shRNA shRNA Plasmid DNA
CD40 ligand
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-294s21c1
Sequence:CCGGTGTCAAGGATATAACGTTAAACTCGAGTTTAACGTTATATCCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011616.2-872s21c1
Sequence:CCGGCTGTGTTGAACTGCCTATTTACTCGAGTAAATAGGCAGTTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-620s21c1
Sequence:CCGGTCTTACTCAAGGCGGCAAATACTCGAGTATTTGCCGCCTTGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011616.2-871s1c1
Sequence:CCGGCCTGTGTTGAACTGCCTATTTCTCGAGAAATAGGCAGTTCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-529s1c1
Sequence:CCGGCAAGTCACCTTCTGCTCTAATCTCGAGATTAGAGCAGAAGGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-718s1c1
Sequence:CCGGGTGTTTGTCAACGTGACTGAACTCGAGTTCAGTCACGTTGACAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-286s1c1
Sequence:CCGGGAAGACCTTGTCAAGGATATACTCGAGTATATCCTTGACAAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-426s1c1
Sequence:CCGGGTGGGCCAAGAAAGGATATTACTCGAGTAATATCCTTTCTTGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011616
CD40LG MISSION shRNA Lentiviral Transduction Particles
CD40 ligand
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-294s21c1
Sequence:CCGGTGTCAAGGATATAACGTTAAACTCGAGTTTAACGTTATATCCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011616.2-872s21c1
Sequence:CCGGCTGTGTTGAACTGCCTATTTACTCGAGTAAATAGGCAGTTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011616.2-620s21c1
Sequence:CCGGTCTTACTCAAGGCGGCAAATACTCGAGTATTTGCCGCCTTGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011616.2-871s1c1
Sequence:CCGGCCTGTGTTGAACTGCCTATTTCTCGAGAAATAGGCAGTTCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-529s1c1
Sequence:CCGGCAAGTCACCTTCTGCTCTAATCTCGAGATTAGAGCAGAAGGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-718s1c1
Sequence:CCGGGTGTTTGTCAACGTGACTGAACTCGAGTTCAGTCACGTTGACAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-286s1c1
Sequence:CCGGGAAGACCTTGTCAAGGATATACTCGAGTATATCCTTGACAAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011616.2-426s1c1
Sequence:CCGGGTGGGCCAAGAAAGGATATTACTCGAGTAATATCCTTTCTTGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000074
CD40LG MISSION shRNA Bacterial Glycerol Stock
CD40 ligand
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-621s21c1
Sequence:CCGGTTCGAGTCAAGCTCCATTTATCTCGAGATAAATGGAGCTTGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-889s21c1
Sequence:CCGGTGACGCTGGGAGTCTTCATAACTCGAGTTATGAAGACTCCCAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-1056s21c1
Sequence:CCGGTGCTCCATAAGAGCTTATATACTCGAGTATATAAGCTCTTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-544s21c1
Sequence:CCGGGGGAAACAGCTGACCGTTAAACTCGAGTTTAACGGTCAGCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-693s1c1
Sequence:CCGGCGGGCAACAATCCATTCACTTCTCGAGAAGTGAATGGATTGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-586s1c1
Sequence:CCGGGCTTCGAGTCAAGCTCCATTTCTCGAGAAATGGAGCTTGACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-174s1c1
Sequence:CCGGTCTTCATAGAAGGTTGGACAACTCGAGTTGTCCAACCTTCTATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-633s1c1
Sequence:CCGGCGGTAGATTCGAGAGAATCTTCTCGAGAAGATTCTCTCGAATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-479s1c1
Sequence:CCGGCCATGAGCAACAACTTGGTAACTCGAGTTACCAAGTTGTTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000074
CD40LG MISSION shRNA shRNA Plasmid DNA
CD40 ligand
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-621s21c1
Sequence:CCGGTTCGAGTCAAGCTCCATTTATCTCGAGATAAATGGAGCTTGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-889s21c1
Sequence:CCGGTGACGCTGGGAGTCTTCATAACTCGAGTTATGAAGACTCCCAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-1056s21c1
Sequence:CCGGTGCTCCATAAGAGCTTATATACTCGAGTATATAAGCTCTTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-544s21c1
Sequence:CCGGGGGAAACAGCTGACCGTTAAACTCGAGTTTAACGGTCAGCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-693s1c1
Sequence:CCGGCGGGCAACAATCCATTCACTTCTCGAGAAGTGAATGGATTGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-586s1c1
Sequence:CCGGGCTTCGAGTCAAGCTCCATTTCTCGAGAAATGGAGCTTGACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-174s1c1
Sequence:CCGGTCTTCATAGAAGGTTGGACAACTCGAGTTGTCCAACCTTCTATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-633s1c1
Sequence:CCGGCGGTAGATTCGAGAGAATCTTCTCGAGAAGATTCTCTCGAATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-479s1c1
Sequence:CCGGCCATGAGCAACAACTTGGTAACTCGAGTTACCAAGTTGTTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000074
CD40LG MISSION shRNA Lentiviral Transduction Particles
CD40 ligand
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-621s21c1
Sequence:CCGGTTCGAGTCAAGCTCCATTTATCTCGAGATAAATGGAGCTTGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-889s21c1
Sequence:CCGGTGACGCTGGGAGTCTTCATAACTCGAGTTATGAAGACTCCCAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000074.2-1056s21c1
Sequence:CCGGTGCTCCATAAGAGCTTATATACTCGAGTATATAAGCTCTTATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000074.2-544s21c1
Sequence:CCGGGGGAAACAGCTGACCGTTAAACTCGAGTTTAACGGTCAGCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-693s1c1
Sequence:CCGGCGGGCAACAATCCATTCACTTCTCGAGAAGTGAATGGATTGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-586s1c1
Sequence:CCGGGCTTCGAGTCAAGCTCCATTTCTCGAGAAATGGAGCTTGACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-174s1c1
Sequence:CCGGTCTTCATAGAAGGTTGGACAACTCGAGTTGTCCAACCTTCTATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-633s1c1
Sequence:CCGGCGGTAGATTCGAGAGAATCTTCTCGAGAAGATTCTCTCGAATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000074.1-479s1c1
Sequence:CCGGCCATGAGCAACAACTTGGTAACTCGAGTTACCAAGTTGTTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks