EMAIL THIS PAGE TO A FRIEND

CD44

CD44 molecule (Indian blood group)

283 Gene Product Result for
Synonyms: CDW44 CSPG8 ECMR-III HCELL HUTCH-I IN LHR MC56 MDU2 MDU3 MIC4 Pgp1
Gene ID:
Human(960) Summary: The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
Mouse(12505) CD44 antigen
Rat(25406) Cd44 molecule
chicken(395666) CD44 molecule (Indian blood group)
cow(281057) CD44 molecule (Indian blood group)
Horse(100034221) CD44 molecule (Indian blood group)
domestic cat(101098744) CD44 molecule (Indian blood group)
dog(403939) CD44 molecule (Indian blood group)
naked mole-rat(101702081) CD44 molecule (Indian blood group)
domestic guinea pig(100731707) CD44 molecule (Indian blood group)
sheep(101113884) CD44 molecule (Indian blood group)
Domestic Rabbit(100301546) CD44 molecule (Indian blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22755 Anti-CD44 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1405590 Anti-CD44 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA005785 Anti-CD44 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300691 Anti-CD44 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5500068 Anti-CD44 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP37, tissue culture supernatant human (tested)
immunohistochemistry, western blot pricing
SAB4504135 Anti-phospho-CD44 (pSer706) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301411 Anti-phospho-CD44 (pSer706) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
C7923 Monoclonal Anti-CD44 antibody produced in mouse clone A3D8, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1402714 Monoclonal Anti-CD44 antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700179 Monoclonal Anti-CD44 antibody produced in mouse clone MEM-85, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700184 Monoclonal Anti-CD44 antibody produced in mouse clone MEM-263, purified immunoglobulin, buffered aqueous solution pig, human, canine
flow cytometry pricing
SAB4700188 Monoclonal Anti-CD44 antibody produced in rat clone IM7, purified immunoglobulin, buffered aqueous solution mouse, human, horse, feline, canine
flow cytometry pricing
SAB4700180 Monoclonal Anti-CD44-APC antibody produced in mouse clone MEM-85, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700185 Monoclonal Anti-CD44-APC antibody produced in mouse clone MEM-263, purified immunoglobulin, buffered aqueous solution pig, canine, human
flow cytometry pricing
SAB4700181 Monoclonal Anti-CD44-Biotin antibody produced in mouse clone MEM-85, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700182 Monoclonal Anti-CD44-FITC antibody produced in mouse clone MEM-85, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700186 Monoclonal Anti-CD44-FITC antibody produced in mouse clone MEM-263, purified immunoglobulin, buffered aqueous solution canine, pig, human
flow cytometry pricing
SAB4700189 Monoclonal Anti-CD44-FITC antibody produced in rat clone IM7, purified immunoglobulin, buffered aqueous solution canine, human, mouse
flow cytometry pricing
SAB4700183 Monoclonal Anti-CD44-PE antibody produced in mouse clone MEM-85, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700187 Monoclonal Anti-CD44-PE antibody produced in mouse clone MEM-263, purified immunoglobulin, buffered aqueous solution pig, canine, human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094691 MISSION® esiRNA esiRNA human CD44 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF412 Anti-CD4 Antibody (mouse), FITC, clone GK1.5 100 µg, This Rat Monoclonal Antibody Anti-CD4 (mouse), FITC, clone GK1.5, Cat. No. MABF412 is validated for use in IP, IHC, FC for the detection of CD4. pricing
MABF743 Anti-CD4 Antibody (mouse), PE-Cy5, clone GK1.5 100 µg, This Rat Monoclonal Antibody Anti-CD4 (mouse), PE-Cy5, clone GK1.5, Cat. No. MABF743 is validated for use in IP, IHC, FC for the detection of CD4. pricing
CBL1508F Anti-CD44 Antibody, clone OX-50, FITC conjugated 100 assays, Detect CD44 using this Anti-CD44 Antibody, clone OX-50, FITC conjugated validated for use in FC, IH. pricing
MABF423 Anti-CD44 Antibody (human/mouse), APC, clone IM7 100 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), APC, clone IM7 validated for use in Western Blot, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF580 Anti-CD44 Antibody (human/mouse), APC, clone IM7 25 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), APC, clone IM7 validated for use in Western Blot, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF424 Anti-CD44 Antibody (human/mouse), APC-Cy7, clone IM7 100 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), APC-Cy7, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF581 Anti-CD44 Antibody (human/mouse), APC-Cy7, clone IM7 25 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), APC-Cy7, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF425 Anti-CD44 Antibody (human/mouse), PE-Cy5, clone IM7 100 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PE-Cy5, clone IM7 validated for use in Western Blottting, IP, IHC & Flow Cytometry for the detection of CD44. This CD44 Antibody has been tested in Human and Mouse. pricing
MABF582 Anti-CD44 Antibody (human/mouse), PE-Cy5, clone IM7 25 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PE-Cy5, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF426 Anti-CD44 Antibody (human/mouse), PE-Cy7, clone IM7 100 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PE-Cy7, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF583 Anti-CD44 Antibody (human/mouse), PE-Cy7, clone IM7 25 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PE-Cy7, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF427 Anti-CD44 Antibody (human/mouse), PerCP-Cy5.5, clone IM7 100 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PerCP-Cy5.5, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF584 Anti-CD44 Antibody (human/mouse), PerCP-Cy5.5, clone IM7 25 µg, This rat monoclonal antibody Anti-CD44 (human/mouse), PerCP-Cy5.5, clone IM7 validated for use in western blotting, IP, IHC & Flow Cytometry for the detection of CD44. pricing
MABF155D Anti-CD44, (human/mouse), FITC, clone IM7 Antibody 25 μg, This rat monoclonal Anti-CD44 Antibody, (human/mouse), FITC, clone IM7, Cat. No. MABF1556 is validated for use in Flow Cytometry, for the detection of CD44. pricing
MABF155E Anti-CD44, (human/mouse), PE, clone IM7 Antibody 25 μg, This Anti-CD44, (human/mouse), PE, clone IM7 Antibody is validated for use in Flow Cytometry for the detection of CD44. pricing
MABF156A Anti-CD44, (human/mouse), violetFluor™ 450, clone IM7 Antibody 25 μg, Anti-CD44, (human/mouse), violetFluor™ 450, clone IM7 Antibody detects level of CD44 and has been published and validated for use in Flow Cytometry. pricing
MABF156B Anti-CD44, (human/mouse), violetFluor™ 710, clone IM7 Antibody 25 μg, Anti-CD44, (human/mouse), violetFluor™ 710, clone IM7 Antibody is an antibody against CD44 for use in Flow Cytometry. pricing
AB2082 Anti-CD44v10 Antibody, exon v10 100 µg, This Anti-CD44v10 Antibody, exon v10 is validated for use in ELISA, FC, IP, RIA, WB, IC, IH(P) for the detection of CD44v10. pricing
AB2080 Anti-CD44v6 Antibody, exon v6 100 µg, Anti-CD44v6 Antibody, exon v6 is an antibody against CD44v6 for use in ELISA, FC, IP, WB, IC, IH(P). pricing
MAB4073 Anti-CD44v6 Antibody, exon v6, clone VFF-18 100 µg, This Anti-CD44v6 Antibody, exon v6, clone VFF-18 is validated for use in FC, WB, IC, IH(P) for the detection of CD44v6. pricing
AB2083 Anti-CD44v7 Antibody, exon v7 100 µg, Detect CD44v7 using this Anti-CD44v7 Antibody, exon v7 validated for use in ELISA, FC, IP, WB, IC, IH(P). pricing
CBL154 Anti-H-CAM Antibody, clone F10-44-2 100 µg, This Anti-H-CAM Antibody, clone F10-44-2 is validated for use in FC, IP, IH, IH(P) for the detection of H-CAM. pricing
CBL154F Anti-H-CAM Antibody, clone F10-44-2, FITC conjugated 100 assays, Detect H-CAM using this Anti-H-CAM Antibody, clone F10-44-2, FITC conjugated validated for use in FC, IH. pricing
CBL154P Anti-H-CAM Antibody, clone F10-44-2, Phycoerythrin conjugated 100 assays, Anti-H-CAM Antibody, clone F10-44-2, Phycoerythrin conjugated detects level of H-CAM & has been published & validated for use in FC. pricing
MAB4065 Anti-H-CAM Antibody, Pan, clone SFF-2 100 µg, This Anti-H-CAM Antibody, Pan, clone SFF-2 is validated for use in FC, IC, IH, IH(P) for the detection of H-CAM. pricing
MAB2137 Anti-Homing Receptor Antibody, clone A020 100 µg, Anti-Homing Receptor Antibody, clone A020 is an antibody against Homing Receptor for use in ELISA, FC, IC, IH & WB. pricing
MABT78 Anti-mouse CD44 (H-CAM) Antibody, clone KM201 100 µg, Detect mouse CD44 (H-CAM) using this Anti-mouse CD44 (H-CAM) Antibody, clone KM201 validated for use in FC. pricing
FCMAB426PE Milli-Mark® Anti-mouse CD44 (H-CAM)-PE Antibody, clone KM201 100 tests, This Milli-Mark Anti-mouse CD44 (H-CAM)-PE Antibody, clone KM201 is validated for use in FC for the detection of mouse CD44 (H-CAM). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000610 Rosetta Predictions human pricing
NM_001001389 Rosetta Predictions human pricing
NM_001001390 Rosetta Predictions human pricing
NM_001001391 Rosetta Predictions human pricing
NM_001001392 Rosetta Predictions human pricing
NM_012924 Rosetta Predictions rat pricing
NM_001039150 Rosetta Predictions mouse pricing
NM_001039151 Rosetta Predictions mouse pricing
NM_009851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302917 predicted 2172
2 SASI_Hs02_00302918 predicted 1928
3 SASI_Hs01_00054792 predicted 1461
4 SASI_Hs01_00054793 predicted 1779
5 SASI_Hs01_00054794 predicted 2025
6 SASI_Hs01_00054795 predicted 853
7 SASI_Hs01_00054796 predicted 2547
8 SASI_Hs01_00054798 predicted 2276
9 SASI_Hs01_00054799 predicted 1856
10 SASI_Hs01_00054800 predicted 860
11 SASI_Hs01_00054797 predicted 2423
12 SASI_Hs01_00054801 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303728 predicted 2046
2 SASI_Hs02_00303729 predicted 1799
3 SASI_Hs01_00014954 predicted 1332
4 SASI_Hs01_00014955 predicted 1646
5 SASI_Hs01_00014956 predicted 1894
6 SASI_Hs01_00014957 predicted 850
7 SASI_Hs01_00014959 predicted 2423
8 SASI_Hs01_00014961 predicted 2153
9 SASI_Hs01_00014962 predicted 1726
10 SASI_Hs01_00014963 predicted 859
11 SASI_Hs01_00014958 predicted 1087
12 SASI_Hs01_00014960 predicted 2296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090826 predicted 1423
2 SASI_Hs02_00303730 predicted 1177
3 SASI_Hs01_00090827 predicted 1278
4 SASI_Hs01_00090828 predicted 854
5 SASI_Hs01_00090829 predicted 1808
6 SASI_Hs01_00090831 predicted 1227
7 SASI_Hs01_00090832 predicted 1532
8 SASI_Hs01_00090833 predicted 1111
9 SASI_Hs01_00090834 predicted 859
10 SASI_Hs01_00090835 predicted 1444
11 SASI_Hs01_00090830 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020791 predicted 1077
2 SASI_Hs01_00020792 predicted 524
3 SASI_Hs01_00020793 predicted 852
4 SASI_Hs01_00020794 predicted 1176
5 SASI_Hs01_00020795 predicted 1411
6 SASI_Hs01_00020796 predicted 1278
7 SASI_Hs01_00020797 predicted 1135
8 SASI_Hs01_00020798 predicted 861
9 SASI_Hs01_00020799 predicted 849
10 SASI_Hs01_00020800 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083880 predicted 485
2 SASI_Hs01_00083881 predicted 662
3 SASI_Hs01_00083882 predicted 522
4 SASI_Hs01_00083883 predicted 573
5 SASI_Hs01_00083884 predicted 1088
6 SASI_Hs01_00083885 predicted 786
7 SASI_Hs01_00083886 predicted 1101
8 SASI_Hs01_00083887 predicted 1094
9 SASI_Hs01_00083888 predicted 822
10 SASI_Hs01_00083889 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260467 predicted 1875
2 SASI_Rn01_00116534 predicted 1945
3 SASI_Rn01_00116535 predicted 1560
4 SASI_Rn01_00116536 predicted 1156
5 SASI_Rn01_00116538 predicted 546
6 SASI_Rn01_00116539 predicted 897
7 SASI_Rn01_00116540 predicted 2082
8 SASI_Rn01_00116541 predicted 1824
9 SASI_Rn02_00260468 predicted 1986
10 SASI_Rn01_00116543 predicted 407
11 SASI_Rn01_00116537 predicted 833
12 SASI_Rn01_00116542 predicted 2165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104379 predicted 749
2 SASI_Mm01_00104380 predicted 422
3 SASI_Mm01_00104381 predicted 417
4 SASI_Mm01_00104382 predicted 741
5 SASI_Mm01_00104383 predicted 552
6 SASI_Mm02_00289867 predicted 512
7 SASI_Mm01_00104385 predicted 753
8 SASI_Mm01_00104386 predicted 451
9 SASI_Mm01_00104387 predicted 383
10 SASI_Mm01_00104388 predicted 625
11 SASI_Mm01_00104384 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145425 predicted 750
2 SASI_Mm01_00145426 predicted 422
3 SASI_Mm01_00145427 predicted 412
4 SASI_Mm01_00145428 predicted 747
5 SASI_Mm01_00145429 predicted 558
6 SASI_Mm02_00289868 predicted 510
7 SASI_Mm01_00145431 predicted 753
8 SASI_Mm01_00145432 predicted 443
9 SASI_Mm01_00145433 predicted 388
10 SASI_Mm01_00145434 predicted 626
11 SASI_Mm01_00145430 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196419 predicted 757
2 SASI_Mm01_00196420 predicted 418
3 SASI_Mm01_00196421 predicted 414
4 SASI_Mm01_00196422 predicted 749
5 SASI_Mm01_00196423 predicted 558
6 SASI_Mm02_00317235 predicted 504
7 SASI_Mm01_00196425 predicted 751
8 SASI_Mm01_00196426 predicted 442
9 SASI_Mm01_00196427 predicted 386
10 SASI_Mm01_00196428 predicted 621
11 SASI_Mm01_00196424 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000610
VALIDATED
CD44 MISSION shRNA Bacterial Glycerol Stock
CD44 molecule (Indian blood group)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-894s1c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-766s1c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-1435s1c1
Sequence:CCGGCGGAAGTGCTACTTCAGACAACTCGAGTTGTCTGAAGTAGCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-2215s1c1
Sequence:CCGGCCAACTCTAATGTCAATCGTTCTCGAGAACGATTGACATTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-3735s1c1
Sequence:CCGGGCCCTATTAGTGATTTCCAAACTCGAGTTTGGAAATCACTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-2694s21c1
Sequence:CCGGCCGTTGGAAACATAACCATTACTCGAGTAATGGTTATGTTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-894s21c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-766s21c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-855s21c1
Sequence:CCGGGGACCAATTACCATAACTATTCTCGAGAATAGTTATGGTAATTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000610.3-1851s21c1
Sequence:CCGGATGGACTCCAGTCATAGTATACTCGAGTATACTATGACTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000610
VALIDATED
CD44 MISSION shRNA shRNA Plasmid DNA
CD44 molecule (Indian blood group)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-894s1c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-766s1c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-1435s1c1
Sequence:CCGGCGGAAGTGCTACTTCAGACAACTCGAGTTGTCTGAAGTAGCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-2215s1c1
Sequence:CCGGCCAACTCTAATGTCAATCGTTCTCGAGAACGATTGACATTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-3735s1c1
Sequence:CCGGGCCCTATTAGTGATTTCCAAACTCGAGTTTGGAAATCACTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-2694s21c1
Sequence:CCGGCCGTTGGAAACATAACCATTACTCGAGTAATGGTTATGTTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-894s21c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-766s21c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-855s21c1
Sequence:CCGGGGACCAATTACCATAACTATTCTCGAGAATAGTTATGGTAATTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000610.3-1851s21c1
Sequence:CCGGATGGACTCCAGTCATAGTATACTCGAGTATACTATGACTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000610
VALIDATED
CD44 MISSION shRNA Lentiviral Transduction Particles
CD44 molecule (Indian blood group)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-894s1c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-766s1c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-1435s1c1
Sequence:CCGGCGGAAGTGCTACTTCAGACAACTCGAGTTGTCTGAAGTAGCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000610.3-2215s1c1
Sequence:CCGGCCAACTCTAATGTCAATCGTTCTCGAGAACGATTGACATTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000610.3-3735s1c1
Sequence:CCGGGCCCTATTAGTGATTTCCAAACTCGAGTTTGGAAATCACTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-2694s21c1
Sequence:CCGGCCGTTGGAAACATAACCATTACTCGAGTAATGGTTATGTTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-894s21c1
Sequence:CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTCCTTTCTGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-766s21c1
Sequence:CCGGCCTCCCAGTATGACACATATTCTCGAGAATATGTGTCATACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000610.3-855s21c1
Sequence:CCGGGGACCAATTACCATAACTATTCTCGAGAATAGTTATGGTAATTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000610.3-1851s21c1
Sequence:CCGGATGGACTCCAGTCATAGTATACTCGAGTATACTATGACTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009851
CD44 MISSION shRNA Bacterial Glycerol Stock
CD44 molecule (Indian blood group)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1322s1c1
Sequence:CCGGCCTTTCAATAACCATGAGTATCTCGAGATACTCATGGTTATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1576s1c1
Sequence:CCGGCGACCCAATCTCACATCCAATCTCGAGATTGGATGTGAGATTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-2082s1c1
Sequence:CCGGCCGAATTAGCTGGACACTCAACTCGAGTTGAGTGTCCAGCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-453s1c1
Sequence:CCGGCCTCCCACTATGACACATATTCTCGAGAATATGTGTCATAGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1026s1c1
Sequence:CCGGCGGAGTCAAATACCAACCCAACTCGAGTTGGGTTGGTATTTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-2657s21c1
Sequence:CCGGGTGTAGTGCCTACGCCATTAACTCGAGTTAATGGCGTAGGCACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-627s21c1
Sequence:CCGGCCAACCACACAGGAGTATATACTCGAGTATATACTCCTGTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009851.2-4961s21c1
Sequence:CCGGGATACCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009851
CD44 MISSION shRNA shRNA Plasmid DNA
CD44 molecule (Indian blood group)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1322s1c1
Sequence:CCGGCCTTTCAATAACCATGAGTATCTCGAGATACTCATGGTTATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1576s1c1
Sequence:CCGGCGACCCAATCTCACATCCAATCTCGAGATTGGATGTGAGATTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-2082s1c1
Sequence:CCGGCCGAATTAGCTGGACACTCAACTCGAGTTGAGTGTCCAGCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-453s1c1
Sequence:CCGGCCTCCCACTATGACACATATTCTCGAGAATATGTGTCATAGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1026s1c1
Sequence:CCGGCGGAGTCAAATACCAACCCAACTCGAGTTGGGTTGGTATTTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-2657s21c1
Sequence:CCGGGTGTAGTGCCTACGCCATTAACTCGAGTTAATGGCGTAGGCACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-627s21c1
Sequence:CCGGCCAACCACACAGGAGTATATACTCGAGTATATACTCCTGTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009851.2-4961s21c1
Sequence:CCGGGATACCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009851
CD44 MISSION shRNA Lentiviral Transduction Particles
CD44 molecule (Indian blood group)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1322s1c1
Sequence:CCGGCCTTTCAATAACCATGAGTATCTCGAGATACTCATGGTTATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1576s1c1
Sequence:CCGGCGACCCAATCTCACATCCAATCTCGAGATTGGATGTGAGATTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-2082s1c1
Sequence:CCGGCCGAATTAGCTGGACACTCAACTCGAGTTGAGTGTCCAGCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-453s1c1
Sequence:CCGGCCTCCCACTATGACACATATTCTCGAGAATATGTGTCATAGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009851.1-1026s1c1
Sequence:CCGGCGGAGTCAAATACCAACCCAACTCGAGTTGGGTTGGTATTTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-2657s21c1
Sequence:CCGGGTGTAGTGCCTACGCCATTAACTCGAGTTAATGGCGTAGGCACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009851.2-627s21c1
Sequence:CCGGCCAACCACACAGGAGTATATACTCGAGTATATACTCCTGTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009851.2-4961s21c1
Sequence:CCGGGATACCTTCATGTCCATATTTCTCGAGAAATATGGACATGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks